ID: 1174620026

View in Genome Browser
Species Human (GRCh38)
Location 20:51866983-51867005
Sequence TACTCAGCAGCCGGGCACGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174620022_1174620026 28 Left 1174620022 20:51866932-51866954 CCAACAGGAGAACAGATGAACAA No data
Right 1174620026 20:51866983-51867005 TACTCAGCAGCCGGGCACGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174620026 Original CRISPR TACTCAGCAGCCGGGCACGG TGG Intergenic