ID: 1174622439

View in Genome Browser
Species Human (GRCh38)
Location 20:51886170-51886192
Sequence CTCACCGCTGTGGGCTCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174622433_1174622439 -6 Left 1174622433 20:51886153-51886175 CCTGCTCCTGATCCTGCCTCACC No data
Right 1174622439 20:51886170-51886192 CTCACCGCTGTGGGCTCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174622439 Original CRISPR CTCACCGCTGTGGGCTCTCA AGG Intergenic