ID: 1174622812

View in Genome Browser
Species Human (GRCh38)
Location 20:51889346-51889368
Sequence AAACCTGTGTTGGCTGCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174622808_1174622812 1 Left 1174622808 20:51889322-51889344 CCGGCCCTTTAATTTGTAAAACG No data
Right 1174622812 20:51889346-51889368 AAACCTGTGTTGGCTGCTACTGG No data
1174622810_1174622812 -4 Left 1174622810 20:51889327-51889349 CCTTTAATTTGTAAAACGAAAAC No data
Right 1174622812 20:51889346-51889368 AAACCTGTGTTGGCTGCTACTGG No data
1174622809_1174622812 -3 Left 1174622809 20:51889326-51889348 CCCTTTAATTTGTAAAACGAAAA No data
Right 1174622812 20:51889346-51889368 AAACCTGTGTTGGCTGCTACTGG No data
1174622806_1174622812 30 Left 1174622806 20:51889293-51889315 CCTTGGCAGGAACAAAGTGGAAA No data
Right 1174622812 20:51889346-51889368 AAACCTGTGTTGGCTGCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174622812 Original CRISPR AAACCTGTGTTGGCTGCTAC TGG Intergenic
No off target data available for this crispr