ID: 1174633383

View in Genome Browser
Species Human (GRCh38)
Location 20:51977950-51977972
Sequence AGGTCTTTGCAGATGTAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174633380_1174633383 6 Left 1174633380 20:51977921-51977943 CCTGTGAATGTGACTTTATTTGG 0: 36
1: 289
2: 800
3: 1996
4: 3239
Right 1174633383 20:51977950-51977972 AGGTCTTTGCAGATGTAATAAGG No data
1174633378_1174633383 19 Left 1174633378 20:51977908-51977930 CCAATCCTCAATACCTGTGAATG No data
Right 1174633383 20:51977950-51977972 AGGTCTTTGCAGATGTAATAAGG No data
1174633379_1174633383 14 Left 1174633379 20:51977913-51977935 CCTCAATACCTGTGAATGTGACT No data
Right 1174633383 20:51977950-51977972 AGGTCTTTGCAGATGTAATAAGG No data
1174633377_1174633383 20 Left 1174633377 20:51977907-51977929 CCCAATCCTCAATACCTGTGAAT No data
Right 1174633383 20:51977950-51977972 AGGTCTTTGCAGATGTAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174633383 Original CRISPR AGGTCTTTGCAGATGTAATA AGG Intergenic
No off target data available for this crispr