ID: 1174634110

View in Genome Browser
Species Human (GRCh38)
Location 20:51984118-51984140
Sequence AAGAACAGTTTCACTTTTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174634108_1174634110 10 Left 1174634108 20:51984085-51984107 CCAAGACTTTTTTCAATCCTTAT No data
Right 1174634110 20:51984118-51984140 AAGAACAGTTTCACTTTTTTAGG No data
1174634107_1174634110 16 Left 1174634107 20:51984079-51984101 CCTAATCCAAGACTTTTTTCAAT No data
Right 1174634110 20:51984118-51984140 AAGAACAGTTTCACTTTTTTAGG No data
1174634109_1174634110 -7 Left 1174634109 20:51984102-51984124 CCTTATGCACTGAATGAAGAACA No data
Right 1174634110 20:51984118-51984140 AAGAACAGTTTCACTTTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174634110 Original CRISPR AAGAACAGTTTCACTTTTTT AGG Intergenic
No off target data available for this crispr