ID: 1174634867

View in Genome Browser
Species Human (GRCh38)
Location 20:51990290-51990312
Sequence GTCCTTGAGGATCATGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174634863_1174634867 12 Left 1174634863 20:51990255-51990277 CCAACATCTGAGAGTCTGTGTGT No data
Right 1174634867 20:51990290-51990312 GTCCTTGAGGATCATGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174634867 Original CRISPR GTCCTTGAGGATCATGATGA TGG Intergenic
No off target data available for this crispr