ID: 1174637711

View in Genome Browser
Species Human (GRCh38)
Location 20:52016254-52016276
Sequence CTGTCTCAGTGCCAAGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174637707_1174637711 22 Left 1174637707 20:52016209-52016231 CCTGAGTCTTCAAATTATGTTCT No data
Right 1174637711 20:52016254-52016276 CTGTCTCAGTGCCAAGTGCAGGG No data
1174637706_1174637711 27 Left 1174637706 20:52016204-52016226 CCATACCTGAGTCTTCAAATTAT No data
Right 1174637711 20:52016254-52016276 CTGTCTCAGTGCCAAGTGCAGGG No data
1174637709_1174637711 -1 Left 1174637709 20:52016232-52016254 CCACGTGTTTTGAATGCAGGCAC No data
Right 1174637711 20:52016254-52016276 CTGTCTCAGTGCCAAGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174637711 Original CRISPR CTGTCTCAGTGCCAAGTGCA GGG Intergenic
No off target data available for this crispr