ID: 1174639407

View in Genome Browser
Species Human (GRCh38)
Location 20:52030409-52030431
Sequence CCAAATGTACTGTACCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174639407_1174639411 12 Left 1174639407 20:52030409-52030431 CCAGGCTGGTACAGTACATTTGG No data
Right 1174639411 20:52030444-52030466 TCACTGCAACCTCTATCTCCTGG 0: 142
1: 8407
2: 98102
3: 166694
4: 158120
1174639407_1174639412 13 Left 1174639407 20:52030409-52030431 CCAGGCTGGTACAGTACATTTGG No data
Right 1174639412 20:52030445-52030467 CACTGCAACCTCTATCTCCTGGG 0: 89
1: 5410
2: 64517
3: 187575
4: 232157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174639407 Original CRISPR CCAAATGTACTGTACCAGCC TGG (reversed) Intergenic
No off target data available for this crispr