ID: 1174641327

View in Genome Browser
Species Human (GRCh38)
Location 20:52046957-52046979
Sequence CACACTAAACAAATTGCTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174641324_1174641327 21 Left 1174641324 20:52046913-52046935 CCTGCCTCTTCTACATCTTGTCG No data
Right 1174641327 20:52046957-52046979 CACACTAAACAAATTGCTATGGG No data
1174641325_1174641327 17 Left 1174641325 20:52046917-52046939 CCTCTTCTACATCTTGTCGTTGA No data
Right 1174641327 20:52046957-52046979 CACACTAAACAAATTGCTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174641327 Original CRISPR CACACTAAACAAATTGCTAT GGG Intergenic
No off target data available for this crispr