ID: 1174645939

View in Genome Browser
Species Human (GRCh38)
Location 20:52085383-52085405
Sequence AAGTGTTGTCATTAGGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 976
Summary {0: 1, 1: 1, 2: 5, 3: 149, 4: 820}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174645939_1174645944 21 Left 1174645939 20:52085383-52085405 CCAACCTCCTAATGACAACACTT 0: 1
1: 1
2: 5
3: 149
4: 820
Right 1174645944 20:52085427-52085449 CTCACAACAATCCTATGAGTGGG 0: 1
1: 9
2: 59
3: 263
4: 826
1174645939_1174645943 20 Left 1174645939 20:52085383-52085405 CCAACCTCCTAATGACAACACTT 0: 1
1: 1
2: 5
3: 149
4: 820
Right 1174645943 20:52085426-52085448 CCTCACAACAATCCTATGAGTGG 0: 1
1: 4
2: 19
3: 91
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174645939 Original CRISPR AAGTGTTGTCATTAGGAGGT TGG (reversed) Intronic
900426547 1:2582795-2582817 ATGTGATGACATTATGAGGTGGG + Intergenic
901219063 1:7572711-7572733 AGGTGATGGTATTAGGAGGTGGG - Intronic
901442069 1:9283921-9283943 AGGTGGTGGTATTAGGAGGTAGG + Intergenic
902734020 1:18388148-18388170 AGGTGATGGGATTAGGAGGTGGG + Intergenic
902902652 1:19530253-19530275 AAGTGATGGTATTAGGAGGTGGG + Intergenic
903051479 1:20604473-20604495 AAGTGATGGTATTAGGAAGTGGG - Intronic
903256205 1:22102578-22102600 CAGAGTTGTCATTAGGATTTAGG + Intergenic
903482186 1:23661811-23661833 AGGTGATGGTATTAGGAGGTGGG - Intergenic
903528729 1:24013232-24013254 AGGTGATGGTATTAGGAGGTAGG + Intergenic
903531971 1:24037828-24037850 AGGTGATGGTATTAGGAGGTGGG - Intergenic
903604721 1:24567293-24567315 AAGTGTTGTTATCAGTAGGGAGG - Intronic
903985275 1:27222995-27223017 AAGTGATAGTATTAGGAGGTGGG - Intergenic
904636988 1:31889747-31889769 AGGTGATGGTATTAGGAGGTGGG - Intergenic
904868174 1:33599059-33599081 AGGTGATGGTATTAGGAGGTGGG - Intronic
905098734 1:35499281-35499303 AAGTGATGGTATTAGGAGGTAGG + Intronic
905534007 1:38704747-38704769 AAGTGATGGTATTAGGAGGTGGG + Intergenic
905649917 1:39649422-39649444 ATGTGATGATATTAGGAGGTCGG + Intergenic
906231768 1:44170611-44170633 CAGTCTTGTGATTAGAAGGTTGG + Intergenic
906830831 1:49030176-49030198 ATGTGATGCTATTAGGAGGTGGG + Intronic
907020791 1:51065243-51065265 AAGTGTTAGCATTAGAAGGCTGG - Intergenic
907052618 1:51339920-51339942 AGGTGATGGTATTAGGAGGTGGG + Intronic
907715036 1:56918648-56918670 AAGTGATGGCATGAGGAGGTGGG - Intergenic
907838541 1:58134409-58134431 AGGTGATGTTATTAAGAGGTGGG - Intronic
907945205 1:59129585-59129607 TAGTATTGGTATTAGGAGGTGGG + Intergenic
907945387 1:59131332-59131354 AGGTGATGGCATTAAGAGGTGGG + Intergenic
908189759 1:61689937-61689959 ATGTGTTGGTATTAAGAGGTAGG + Intronic
908357521 1:63337213-63337235 AAGTGATGGTATTAGGAGGTGGG + Intergenic
908392473 1:63696226-63696248 AGGTGATGGTATTAGGAGGTGGG + Intergenic
908612708 1:65880485-65880507 AGGTGATGGTATTAGGAGGTTGG + Intronic
908710332 1:67007401-67007423 AAGTCATGGTATTAGGAGGTAGG - Intronic
908900834 1:68954641-68954663 ATGTAATGGCATTAGGAGGTGGG - Intergenic
909191333 1:72556474-72556496 ATGTGATGGCATTAGGAAGTGGG - Intergenic
909870250 1:80729801-80729823 ATCTGATGGCATTAGGAGGTGGG - Intergenic
910445323 1:87294144-87294166 AAGTGTTTTCAATAAGAGGGTGG - Intergenic
910469608 1:87538053-87538075 ATGTGTTGGCATTTGGAAGTGGG + Intergenic
910544388 1:88397737-88397759 AGGTGATGGTATTAGGAGGTGGG - Intergenic
910551469 1:88480404-88480426 AGGTGATGGCATTAGGAGGTGGG - Intergenic
910593158 1:88949951-88949973 AGGTGATGGTATTAGGAGGTGGG + Intronic
910654726 1:89608354-89608376 ATGTGATGGTATTAGGAGGTGGG + Intergenic
911099871 1:94087129-94087151 AGATGATGGCATTAGGAGGTGGG - Intronic
911156070 1:94638127-94638149 AAGTGGTGGTATTAGGAGCTGGG + Intergenic
911228549 1:95334547-95334569 AAGTGATGATATTAGGAGATGGG - Intergenic
911381893 1:97125625-97125647 AAGTGATGGTAGTAGGAGGTAGG + Intronic
911386155 1:97178022-97178044 AGGTGATGCTATTAGGAGGTGGG - Intronic
911445893 1:97991190-97991212 AAGTGTTGGCATTAGTAGGCTGG - Intergenic
912174082 1:107137097-107137119 ATGTGATGGTATTAGGAGGTAGG + Intergenic
913051989 1:115125469-115125491 GTGTGTTGACATTTGGAGGTAGG + Intergenic
913351496 1:117866142-117866164 AAGTGATGGCATTTGGAGGTGGG + Exonic
913355243 1:117913801-117913823 ATGTGATGGTATTAGGAGGTAGG + Intronic
913377483 1:118169098-118169120 AAGTGTTGCCAGTATGAGTTTGG - Intronic
914376176 1:147075889-147075911 AAGTGTTAAAATTAGGAGGAGGG + Intergenic
914398062 1:147289706-147289728 AAGTGTTGTAATGAGCAGTTGGG - Intronic
914506929 1:148297375-148297397 AAGTGTTAAAATTAGGAGGAGGG - Intergenic
915222287 1:154384736-154384758 AAGCATCGTCATTTGGAGGTTGG - Intergenic
915826416 1:159082726-159082748 ATGTGATGATATTAGGAGGTGGG - Intronic
915939205 1:160107976-160107998 ATGTGATGGTATTAGGAGGTGGG - Intergenic
916528776 1:165636210-165636232 GTGTGTTGTCATTTTGAGGTGGG + Intronic
917284254 1:173407870-173407892 GAGTGATGGTATTAGGAGGTGGG + Intergenic
917637117 1:176948257-176948279 AAGTTCTGTCCTTAGCAGGTCGG + Intronic
917724550 1:177816305-177816327 CAGTGATGATATTAGGAGGTGGG + Intergenic
917742332 1:177972780-177972802 ATGTGATGGTATTAGGAGGTAGG + Intronic
918025503 1:180740995-180741017 ATGTGATGGTATTAGGAGGTGGG - Intronic
918482143 1:184990444-184990466 AGGTGATGATATTAGGAGGTGGG + Intergenic
919066336 1:192696466-192696488 AGGTGATGGCATTAGGAAGTGGG + Intergenic
919481369 1:198093943-198093965 AAATGATGATATTAGGAGGTGGG - Intergenic
919588449 1:199469044-199469066 ATGTGATGATATTAGGAGGTGGG - Intergenic
919687641 1:200499191-200499213 AGGTGATGATATTAGGAGGTGGG + Intergenic
920717560 1:208354992-208355014 AAGTCTTGCCATTTAGAGGTGGG - Intergenic
920747231 1:208640437-208640459 ATGTGATGGCGTTAGGAGGTGGG + Intergenic
921655805 1:217735453-217735475 ATGTGATGGCATTTGGAGGTGGG - Intronic
921727329 1:218538348-218538370 AAGTGTTGATATTAAGAGATGGG + Intergenic
921783783 1:219201259-219201281 AAGTTTTCTCATTAGAACGTGGG + Intronic
922360102 1:224813361-224813383 ATGTGATGATATTAGGAGGTGGG + Intergenic
922727480 1:227929476-227929498 AAGTGGTAGCATTAGGAGGTGGG + Intronic
922823771 1:228503009-228503031 AGGTGATGGTATTAGGAGGTGGG - Intergenic
922860364 1:228811093-228811115 AGGTGATGGTATTAGGAGGTGGG - Intergenic
922972661 1:229755959-229755981 ATGTGATGGTATTAGGAGGTGGG - Intergenic
923130959 1:231074389-231074411 AGGTGATGATATTAGGAGGTGGG + Intergenic
923210279 1:231797634-231797656 AGGTGATGGCATTAGGAGGTGGG - Intronic
923378106 1:233386938-233386960 AAGTTTTGGAATTAAGAGGTGGG + Intergenic
924173594 1:241366600-241366622 AAGTGATGGTATTAGGAGATGGG + Intergenic
924330442 1:242935866-242935888 AAGTGATGGCACTAGGAGGTGGG + Intergenic
924562758 1:245170766-245170788 AAGTGATGGTAGTAGGAGGTGGG - Intronic
924803794 1:247347050-247347072 TTGTGATGGCATTAGGAGGTGGG - Intergenic
1063267671 10:4472635-4472657 ATGTGTTGGTATTTGGAGGTGGG + Intergenic
1063276895 10:4579088-4579110 AAGTGATGATATCAGGAGGTGGG - Intergenic
1063781894 10:9334438-9334460 AAGTGATGGTATTAGGAGGTGGG + Intergenic
1064710466 10:18118714-18118736 ATGTGATGACATTAAGAGGTGGG - Intergenic
1064850537 10:19704499-19704521 AAGCGACGGCATTAGGAGGTGGG - Intronic
1065127682 10:22589959-22589981 AAGTGATGGTATTAGGAGGTGGG + Intronic
1065171533 10:23035298-23035320 ATGTGATGGCATTTGGAGGTGGG - Intronic
1065285427 10:24182938-24182960 ATGTGGTGGCATTAGGAGATGGG + Intronic
1065792278 10:29271822-29271844 AGGTGATGGTATTAGGAGGTGGG + Intergenic
1065941859 10:30572135-30572157 AAGTGATGATATTAGGAGATTGG + Intergenic
1066019489 10:31283770-31283792 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1066566699 10:36728861-36728883 CAGTGTTGGGATTTGGAGGTGGG - Intergenic
1066608874 10:37213419-37213441 AGGTGATGTTATTAGGAGGTAGG - Intronic
1067221249 10:44345892-44345914 AGGTGATGGTATTAGGAGGTGGG - Intergenic
1067347641 10:45448124-45448146 AGGTGATGGCATTAGGAGGAGGG - Intergenic
1068391471 10:56402635-56402657 ATGTGATGATATTAGGAGGTGGG - Intergenic
1068805057 10:61185960-61185982 AATTGTTGTGATTAGTAGATTGG - Intergenic
1068863703 10:61872270-61872292 AAGTGATGGTATTAGGAGGTGGG - Intergenic
1069036971 10:63655922-63655944 AGGTGATGGCATTAGGAGGTGGG + Intergenic
1069069639 10:63979997-63980019 ATGTGATGGCATTAAGAGGTGGG - Intergenic
1069203592 10:65653986-65654008 TAATGCTGTCATTTGGAGGTAGG - Intergenic
1069337983 10:67375876-67375898 AAGTGATGATATTAGAAGGTGGG + Intronic
1071056736 10:81520183-81520205 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1071300337 10:84251785-84251807 ATGTGATGGCATTTGGAGGTGGG - Intronic
1071479270 10:86052038-86052060 AAATGTTATCATTAGGAAGCTGG + Intronic
1072642347 10:97221492-97221514 ATGTGATGATATTAGGAGGTAGG + Intronic
1072708684 10:97701078-97701100 AGGTGGTGGTATTAGGAGGTAGG - Intergenic
1073080918 10:100860211-100860233 AGGTGGTGGCACTAGGAGGTGGG - Intergenic
1073674802 10:105633686-105633708 ATGTGATGGCATTAAGAGGTGGG + Intergenic
1073882139 10:107995403-107995425 AAGTGATGTTATCAGAAGGTGGG + Intergenic
1074606282 10:114971220-114971242 AGGTGTTGATATTAGGAGGTAGG - Intronic
1075053181 10:119198490-119198512 ATGTGATGGTATTAGGAGGTGGG - Intergenic
1075180447 10:120206191-120206213 AAGTGCTCTCATTAGGAGGTTGG - Intergenic
1075580715 10:123616109-123616131 ACGTGATGGTATTAGGAGGTGGG + Intergenic
1075681412 10:124335499-124335521 AAGTGATGGTGTTAGGAGGTTGG - Intergenic
1076270332 10:129147089-129147111 AAGTGGTGTCATTTGGTGGATGG - Intergenic
1076350845 10:129814265-129814287 AAGTGATGGCATTAAGAGGTGGG + Intergenic
1077869993 11:6253670-6253692 AACTGTTGTCATTACAAGATGGG - Intergenic
1078005644 11:7530419-7530441 AAGTGATGGTATTAGGAGGTGGG + Intronic
1078056679 11:8014891-8014913 AAGCGATGGTATTAGGAGGTGGG - Intergenic
1078471923 11:11595207-11595229 AGGTGATGTCTTTAGAAGGTGGG + Intronic
1078520540 11:12059659-12059681 AAGTGATGGTATTAGGAGGTAGG + Intergenic
1078863979 11:15279751-15279773 AAGTGATGGTATTAAGAGGTGGG + Intergenic
1079257461 11:18844542-18844564 AAGGGTTTCCATTAGGAGTTTGG + Intergenic
1079620851 11:22552190-22552212 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1079755952 11:24262283-24262305 ATGTGTTGGTATTAAGAGGTGGG - Intergenic
1079909658 11:26293911-26293933 AAGTGTTGTAACTAGGATTTGGG + Intergenic
1080053482 11:27881186-27881208 ATGTGATGGGATTAGGAGGTAGG + Intergenic
1080260540 11:30345042-30345064 CAGTGATGGTATTAGGAGGTGGG - Intergenic
1080282231 11:30570337-30570359 AGGTGGTGGTATTAGGAGGTGGG - Intronic
1080412110 11:32035423-32035445 ATGTGATGGCATTAGGAGGTGGG - Intronic
1080801419 11:35613732-35613754 ATATGGTGGCATTAGGAGGTAGG - Intergenic
1081366479 11:42241464-42241486 ATGTGCTGGTATTAGGAGGTGGG - Intergenic
1081598927 11:44478649-44478671 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1081692045 11:45085308-45085330 ACATGTTGGCATTAAGAGGTAGG - Intergenic
1081695267 11:45105246-45105268 ATGTGATGGTATTAGGAGGTGGG - Intronic
1082867358 11:57912107-57912129 AGGTGATGTTATTAGGAGGTGGG + Intergenic
1083145181 11:60752833-60752855 TCGTGATGGCATTAGGAGGTGGG - Intergenic
1084759592 11:71260963-71260985 ATTTGGTGGCATTAGGAGGTGGG + Intergenic
1085446254 11:76603171-76603193 AGGTGATGCTATTAGGAGGTGGG - Intergenic
1085583567 11:77678609-77678631 AGGTGATGGTATTAGGAGGTGGG + Intronic
1085654145 11:78297004-78297026 ATGTGTTGGTATTAGGAGGTGGG - Intronic
1086129962 11:83391027-83391049 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1086313722 11:85566677-85566699 AAGTGATGGTATTAGGACGTGGG - Intronic
1086572081 11:88296731-88296753 AAGTGATGGTCTTAGGAGGTGGG + Intronic
1087186527 11:95204522-95204544 ATGTGATGGTATTAGGAGGTGGG + Intronic
1087477704 11:98657863-98657885 ATGTGATCTCATTAGGAGTTGGG + Intergenic
1087698367 11:101407264-101407286 AGGTGATGGTATTAGGAGGTGGG - Intergenic
1087923163 11:103890169-103890191 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1087963086 11:104376167-104376189 CAGTGATGACATTAGTAGGTAGG - Intergenic
1088119647 11:106352824-106352846 AGGTGGTGCCATTAGGAGGGTGG + Intergenic
1088130935 11:106489918-106489940 AAGTGATAGTATTAGGAGGTAGG - Intergenic
1088364189 11:109021533-109021555 AAGTTATAGCATTAGGAGGTGGG - Intergenic
1088713417 11:112528077-112528099 ATGTGATGGAATTAGGAGGTGGG + Intergenic
1088983840 11:114888325-114888347 TAGTGATGATATTAGGAGGTAGG - Intergenic
1089551134 11:119279195-119279217 GAGTCTTGGCATTAGAAGGTTGG + Intronic
1089659502 11:119976878-119976900 GAGTGATGGAATTAGGAGGTGGG - Intergenic
1089731070 11:120519315-120519337 AAGTGATAGTATTAGGAGGTGGG + Intronic
1089827039 11:121287426-121287448 AAGTGATGTTACTAGGAGGTGGG - Intergenic
1090158871 11:124470516-124470538 CAGTGTTGTCAGTGGGATGTAGG + Intergenic
1090299963 11:125626470-125626492 AATTGTTGTTATGAAGAGGTGGG - Intronic
1090433382 11:126665460-126665482 AGGTGATGCTATTAGGAGGTGGG + Intronic
1090834215 11:130442194-130442216 AAGTATTTTTATTAGGAGGGAGG + Intergenic
1090886427 11:130880922-130880944 AGGTGATGGCAGTAGGAGGTGGG + Intronic
1091539451 12:1446034-1446056 ACGTGATGGTATTAGGAGGTGGG - Intronic
1091924648 12:4335435-4335457 ATATGATGACATTAGGAGGTGGG + Intronic
1092660129 12:10729596-10729618 AAGCGATGGCATTAGGAGATGGG - Intergenic
1092931735 12:13321946-13321968 AAGTGGTGGTATTTGGAGGTGGG + Intergenic
1093007474 12:14065853-14065875 TAGTGATTTCATTAGGAGGCAGG + Intergenic
1093010347 12:14100933-14100955 ATGTGATGGCATTTGGAGGTGGG - Intergenic
1093012563 12:14124484-14124506 AAGTGATGGTATTAGGAGGTGGG - Intergenic
1093070332 12:14701730-14701752 AAGTGATGCTATTAGAAGGTAGG + Intergenic
1093331893 12:17853777-17853799 AGGTGATGGCATTAGGAAGTGGG + Intergenic
1093480319 12:19597802-19597824 GAGTGATGGTATTAGGAGGTGGG + Intronic
1094027408 12:25973642-25973664 AGGTGATGGCATTTGGAGGTGGG + Intronic
1094289756 12:28833701-28833723 TAGTGTGGCCATTTGGAGGTAGG - Intergenic
1095159403 12:38899216-38899238 ATGTGATGATATTAGGAGGTAGG + Intronic
1095315613 12:40757233-40757255 ACGTGATGGCATTAGGAGGTGGG - Intronic
1095547519 12:43388978-43389000 AGGTGATGGTATTAGGAGGTGGG - Intronic
1095547747 12:43391262-43391284 AGGTGATGGTATTAGGAGGTAGG - Intronic
1095903085 12:47348712-47348734 CTGTGATGACATTAGGAGGTGGG + Intergenic
1098327046 12:69313729-69313751 AGGTGATGGTATTAGGAGGTGGG + Intergenic
1098950848 12:76639183-76639205 ATGTGTTGATATTAAGAGGTGGG - Intergenic
1099028502 12:77495444-77495466 AAGTGATGGTATTAGGAGGTGGG - Intergenic
1099390363 12:82071675-82071697 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1099507486 12:83497576-83497598 AAGTGATGGTATTATGAGGTGGG + Intergenic
1099593311 12:84623938-84623960 AGGTGATGCTATTAGGAGGTGGG + Intergenic
1099648460 12:85392189-85392211 ATGTGATGGTATTAGGAGGTGGG - Intergenic
1099892112 12:88602707-88602729 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1100288067 12:93186708-93186730 AAGTGATGGTATTAAGAGGTGGG + Intergenic
1100476529 12:94940463-94940485 ATGTGATGGTATTAGGAGGTAGG + Intronic
1100702461 12:97162998-97163020 AGGTGATGACATTAGGAGTTGGG + Intergenic
1100866805 12:98866074-98866096 AAGTGATGGTATTAGGAGGTGGG - Intronic
1100901940 12:99251111-99251133 AAGTGATGGTAATAGGAGGTGGG - Intronic
1101051830 12:100871860-100871882 ATGTGATGACATTAGGAGGTAGG - Intronic
1101860854 12:108481359-108481381 AGGTGATGACATTAGGAGGTAGG + Intergenic
1102559526 12:113752416-113752438 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1103393850 12:120592958-120592980 AAGTGATGGCATTAGGAGGTGGG + Intergenic
1103449438 12:121018113-121018135 AGGTGATGGTATTAGGAGGTGGG + Intergenic
1103895873 12:124272792-124272814 ATGTGATGGCATTAGGAGGTGGG + Intronic
1104002898 12:124871766-124871788 ATGTGATGGTATTAGGAGGTAGG + Intronic
1104025153 12:125020458-125020480 AAGTGATGGTCTTAGGAGGTGGG - Intronic
1104110028 12:125696139-125696161 ATGTGATGGTATTAGGAGGTTGG - Intergenic
1104407039 12:128526477-128526499 AGGTGTTGGCTTTAGGAGGTGGG - Intronic
1104695711 12:130862218-130862240 AGGTGATGGTATTAGGAGGTGGG - Intergenic
1104703251 12:130923395-130923417 AGGTGATGGTATTAGGAGGTGGG + Intergenic
1104796536 12:131523922-131523944 AAGTGGTGTCATTAGGAGGTGGG + Intergenic
1105529738 13:21208578-21208600 AGGTGATGTTATTAGGAGGTCGG + Intergenic
1105716855 13:23075002-23075024 AGGTGATGGCATTAGGAGGTAGG - Intergenic
1106128101 13:26917289-26917311 AGGTGATGTTATTAAGAGGTAGG - Intergenic
1106502956 13:30346836-30346858 ATGTGGTGTTGTTAGGAGGTGGG + Intergenic
1106551119 13:30771930-30771952 AGGTGATGATATTAGGAGGTCGG + Intergenic
1106894843 13:34288903-34288925 AAGTGATGGTATTTGGAGGTGGG - Intergenic
1107351541 13:39520010-39520032 TAGTGATGTCAGTAGGAAGTGGG + Intronic
1107677118 13:42808962-42808984 AAGCGATGGTATTAGGAGGTGGG + Intergenic
1108134940 13:47346011-47346033 AAATGTTGGTATTAGGAGGTTGG + Intergenic
1108152557 13:47551302-47551324 ATGTGGTGGTATTAGGAGGTGGG - Intergenic
1108506547 13:51117659-51117681 AAGAGTGGTAAGTAGGAGGTAGG - Intergenic
1108710029 13:53024256-53024278 AAGTGATGGAATCAGGAGGTAGG - Intergenic
1109085493 13:57966222-57966244 AAGTGATGGTATTAAGAGGTAGG + Intergenic
1109494010 13:63144879-63144901 AAGTGTTGAAATTGGGAAGTGGG - Intergenic
1109517291 13:63460289-63460311 ATGAGATGGCATTAGGAGGTGGG - Intergenic
1109796976 13:67328160-67328182 AGGTGATGGTATTAGGAGGTGGG + Intergenic
1109859143 13:68174051-68174073 ATGTGTTGTTATTAGGAAGTGGG - Intergenic
1110262516 13:73501353-73501375 ATGTGATGGCATTAGGAGGTGGG + Intergenic
1110351602 13:74515139-74515161 AAGTGATGGTATTAGGGGGTGGG + Intergenic
1110381890 13:74861909-74861931 AGGTGATGGTATTAGGAGGTGGG + Intergenic
1110547221 13:76768801-76768823 AAGTGTAGTCCTGAGGATGTTGG - Intergenic
1110744721 13:79039049-79039071 AAGTGATGGTATTAGGAGGTAGG - Intergenic
1110843670 13:80170331-80170353 ATGTGATGTGATTAGGAGATGGG - Intergenic
1110900111 13:80811595-80811617 AAGTGATGGTAATAGGAGGTGGG + Intergenic
1110931377 13:81222857-81222879 AGGTGGTGGCATTAGGAAGTAGG + Intergenic
1111260549 13:85734266-85734288 ATGTGCTGACATTAGGAGATGGG + Intergenic
1111382549 13:87478061-87478083 ATGTGATGCTATTAGGAGGTGGG + Intergenic
1111527410 13:89491056-89491078 ATGTAAAGTCATTAGGAGGTGGG - Intergenic
1111741584 13:92211988-92212010 ATGTGTTGGTATTTGGAGGTGGG + Intronic
1111889133 13:94059844-94059866 AAGTGATGGTATTAGGAGGTGGG - Intronic
1111910185 13:94302423-94302445 ATGTGATGGAATTAGGAGGTAGG - Intronic
1112608023 13:100927189-100927211 AAGTGATGGTATTAGGAGGTGGG + Intergenic
1112670728 13:101634440-101634462 AAGTTTTGTGCTTAGGAGGCTGG + Intronic
1112719750 13:102230037-102230059 AGGTGATGGTATTAGGAGGTGGG + Intronic
1113191925 13:107758912-107758934 AAGTCTTATCATTTGGAGGTAGG - Intronic
1113298933 13:108995348-108995370 AAGTGATGGGATTAGAAGGTGGG - Intronic
1113374421 13:109750926-109750948 AAGTGCTGGTATTAGGAGGTGGG + Intergenic
1113389071 13:109878402-109878424 AGGTGATGGAATTAGGAGGTAGG + Intergenic
1113450224 13:110404078-110404100 GTGTGTTGGCATTAAGAGGTGGG - Intronic
1115658532 14:35467189-35467211 AGGTGATGGTATTAGGAGGTGGG - Intergenic
1115965653 14:38884669-38884691 AAGTGATGGTATTAGGAGGTGGG + Intergenic
1115977051 14:39008249-39008271 AAGTGATGGTATTAGGAGGTGGG - Intergenic
1116109744 14:40562607-40562629 AAGTGGTGTGATAATGAGGTAGG - Intergenic
1116425480 14:44784998-44785020 AAGTGATGGTTTTAGGAGGTGGG + Intergenic
1116433933 14:44876151-44876173 AAGTGATGATATTAGGAGGTGGG - Intergenic
1116438034 14:44915833-44915855 AAATGATGGCATTAGGAGGTGGG + Intergenic
1116582245 14:46656884-46656906 AGGTGATGGTATTAGGAGGTGGG + Intergenic
1116753151 14:48911755-48911777 AAGTGATGATATTAGGAGATGGG - Intergenic
1117144908 14:52827633-52827655 AGGTGATGGCATTAGGAGGTGGG + Intergenic
1117303653 14:54452163-54452185 AAGTGATGGTATTAGGAGGTGGG - Intergenic
1117435159 14:55708829-55708851 ATGTGATGGTATTAGGAGGTGGG - Intergenic
1118507624 14:66430796-66430818 CAGTTTTCTCATTAGGATGTTGG + Intergenic
1119537214 14:75412307-75412329 AAGTGATGGTATTAGGAAGTAGG + Intergenic
1119680111 14:76585720-76585742 AAGTGATGACATTAGGAGGCGGG - Intergenic
1119768036 14:77202977-77202999 AAGTGTTGTAATAAGGATGTGGG - Intronic
1120055938 14:79924148-79924170 ATGTGAAGTTATTAGGAGGTAGG - Intergenic
1120498931 14:85269801-85269823 AGGTGATGGTATTAGGAGGTGGG - Intergenic
1121069901 14:91009166-91009188 GTGTGTTGACATTAAGAGGTGGG + Intronic
1121300191 14:92863974-92863996 AAGTAATGGCATTTGGAGGTGGG - Intergenic
1121327327 14:93028835-93028857 AAGTGTTCTCAATGGGAGGGAGG - Intronic
1121625284 14:95380941-95380963 AACTGATGGTATTAGGAGGTGGG + Intergenic
1121875753 14:97450023-97450045 AAGTGATGGTATTAGGAAGTTGG - Intergenic
1122285166 14:100646975-100646997 AGGTGATGGTATTAGGAGGTGGG + Intergenic
1122369534 14:101221688-101221710 AAGTGATGATATTAGGAAGTGGG + Intergenic
1122376348 14:101262121-101262143 AGGTGATGGTATTAGGAGGTGGG + Intergenic
1122911283 14:104829062-104829084 AAGTGATGGTATTAAGAGGTAGG + Intergenic
1123672558 15:22674113-22674135 ATGTGATGTTATTTGGAGGTGGG - Intergenic
1123710978 15:22987513-22987535 AGATGATGGCATTAGGAGGTGGG + Intronic
1123721445 15:23064995-23065017 TAGTGCAGTCATTTGGAGGTAGG - Intergenic
1123854932 15:24399162-24399184 ATATCTTGTCATTATGAGGTAGG - Intergenic
1124193118 15:27597709-27597731 AGGTGATGGTATTAGGAGGTGGG - Intergenic
1124324608 15:28747402-28747424 ATGTGATGTTATTTGGAGGTGGG - Intergenic
1124356112 15:28996050-28996072 CTGTGTTGTCATTGGGTGGTGGG - Intronic
1124362150 15:29045462-29045484 GTGTGATGGCATTAGGAGGTGGG - Intronic
1124465900 15:29939676-29939698 AAGTGATGGTATTAGGAGGTGGG + Intronic
1124528478 15:30480436-30480458 ATGTGATGTTATTTGGAGGTGGG - Intergenic
1124572569 15:30878559-30878581 ATGTGATGGCATTGGGAGGTGGG + Intergenic
1124770179 15:32527262-32527284 ATGTGATGTTATTTGGAGGTGGG + Intergenic
1124867781 15:33510278-33510300 AAGTGATGTCATGTAGAGGTGGG - Intronic
1125153783 15:36563322-36563344 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1125395504 15:39243275-39243297 AGGTGATGGCATCAGGAGGTAGG - Intergenic
1125441819 15:39711390-39711412 AGGTGATGGGATTAGGAGGTGGG - Intronic
1126377934 15:48014824-48014846 AGGTGATGATATTAGGAGGTAGG - Intergenic
1126699156 15:51352352-51352374 ATGTGATGATATTAGGAGGTGGG - Intronic
1127348229 15:58123208-58123230 AAATCTTGTCATCAGAAGGTTGG + Intronic
1127492247 15:59476178-59476200 ATGTGATGGTATTAGGAGGTGGG - Intronic
1127847651 15:62885451-62885473 AGGTGGTGTCATTCTGAGGTTGG - Intergenic
1127985010 15:64062441-64062463 AAGTGATGGTATTCGGAGGTGGG - Intronic
1128320220 15:66688226-66688248 ATGTGATGATATTAGGAGGTGGG - Intergenic
1129576365 15:76751456-76751478 AAGTTTTGAAATTAGGAAGTGGG - Intronic
1129921930 15:79326710-79326732 AGGTGATGGTATTAGGAGGTGGG + Intronic
1130215906 15:81969336-81969358 AAATGTTGGTATTTGGAGGTGGG - Intergenic
1130331687 15:82927057-82927079 ATGTGATGGTATTAGGAGGTGGG - Intronic
1131345188 15:91640266-91640288 AGGTGATGGTATTAGGAGGTAGG - Intergenic
1131960410 15:97784583-97784605 AAGTGATGGTATTAGGAGGTGGG - Intergenic
1133094333 16:3431097-3431119 AACTGATGTTATTAGGAGGTGGG - Intronic
1133537600 16:6716902-6716924 ATGTGATGGTATTAGGAGGTGGG + Intronic
1133924902 16:10184079-10184101 AGGTGATGGTATTAGGAGGTGGG + Intergenic
1134638543 16:15811030-15811052 AAGTGATGATATTAGGAGGTGGG + Intronic
1134902756 16:17953455-17953477 ATGTGATGGTATTAGGAGGTGGG - Intergenic
1135060080 16:19263957-19263979 AAGTGATGGCATTAGGAGGCGGG + Intronic
1135578587 16:23605783-23605805 ATGTGATGGTATTAGGAGGTGGG + Intronic
1135747970 16:25033336-25033358 AAGTGTTGTCATTCAGAGCATGG + Intergenic
1135981457 16:27150715-27150737 AAGTGATGGGATTAGGAGGTGGG - Intergenic
1136283450 16:29228009-29228031 AAGTGATGGGATTAGGAGGTGGG - Intergenic
1137280012 16:46968497-46968519 AAGGGTTTTTATTAGGAGTTAGG - Intronic
1137660766 16:50204103-50204125 CAGTGTTACCATAAGGAGGTTGG + Intronic
1137781479 16:51101232-51101254 AAGTGATGGTCTTAGGAGGTGGG + Intergenic
1138646466 16:58429048-58429070 AAGTGATGGTATTAGGAAGTGGG - Intergenic
1138668841 16:58596550-58596572 AGGTGTTTTCATCAGAAGGTGGG + Intronic
1139093452 16:63676734-63676756 ATGTGATGGTATTAGGAGGTCGG + Intergenic
1139238955 16:65370769-65370791 AGGTGATGATATTAGGAGGTGGG - Intergenic
1139320047 16:66107022-66107044 AAGTGATGGTATTAGGAGGTGGG - Intergenic
1140324889 16:73991932-73991954 AAGTTTTGAAATTAGGAAGTGGG - Intergenic
1140716735 16:77733469-77733491 AGGTGATGGTATTAGGAGGTGGG - Intronic
1141457632 16:84154416-84154438 ATGTGATGGTATTAGGAGGTGGG - Intronic
1142087876 16:88193959-88193981 AAGTGATGGGATTAGGAAGTGGG - Intergenic
1143908131 17:10226170-10226192 ATGTGTTGGTATTAAGAGGTGGG - Intergenic
1144385004 17:14741243-14741265 AGGTGATGGCATTAGGAGGTGGG - Intergenic
1144531844 17:16046767-16046789 AAGAGTTCTAATTAGGAGGCAGG - Intronic
1145015165 17:19391807-19391829 AGGAGATGTCATCAGGAGGTGGG - Intergenic
1145837546 17:27965969-27965991 AGGTGATGTTATTAGGAGGTGGG - Intergenic
1148716067 17:49716986-49717008 AAGGATTATTATTAGGAGGTAGG + Intronic
1148801278 17:50227954-50227976 AAGTGATAGTATTAGGAGGTGGG + Intergenic
1148957039 17:51362519-51362541 ATGTGATGGTATTAGGAGGTGGG - Intergenic
1149565663 17:57639139-57639161 AGGTGATGATATTAGGAGGTGGG - Intronic
1149991393 17:61385516-61385538 AGGTCCTCTCATTAGGAGGTCGG - Intronic
1150189424 17:63222233-63222255 AGGTGATGGTATTAGGAGGTAGG - Intronic
1150907334 17:69351874-69351896 ATGTGATGTGATTACGAGGTGGG + Intergenic
1150975376 17:70080117-70080139 AAGCAATGTCATTAGAAGGTTGG - Intronic
1151163480 17:72185091-72185113 AAATTTTCTCATTAGGAGGGAGG + Intergenic
1151901670 17:77020073-77020095 ACGTGATGTTATTCGGAGGTGGG - Intergenic
1153040031 18:803752-803774 AAGTGCTCTGATTATGAGGTGGG - Intronic
1153418056 18:4872231-4872253 ATGTGATGGAATTAGGAGGTGGG + Intergenic
1153720094 18:7892936-7892958 AAATGGTGGTATTAGGAGGTGGG - Intronic
1154366309 18:13712497-13712519 AAATTATGACATTAGGAGGTAGG + Intronic
1154482435 18:14845945-14845967 AGGTGACGTTATTAGGAGGTAGG - Intronic
1154495949 18:14961271-14961293 AGGTGATGGTATTAGGAGGTGGG - Intergenic
1155241115 18:23864642-23864664 AAGGGTTGTATCTAGGAGGTGGG - Intronic
1155587823 18:27388192-27388214 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1155829860 18:30500551-30500573 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1155899244 18:31367625-31367647 AGGTGATGGTATTAGGAGGTGGG + Intergenic
1155988503 18:32255436-32255458 ATGTGATGTTATTAGCAGGTAGG - Intronic
1156399772 18:36729725-36729747 AAGTGATGATATTTGGAGGTAGG - Intronic
1156612987 18:38749678-38749700 AAGTGATGGTATTAAGAGGTGGG - Intergenic
1156640974 18:39098282-39098304 TTGTGGTGGCATTAGGAGGTGGG - Intergenic
1156729576 18:40175276-40175298 AAGTGATGGTATTAGGAGGCAGG - Intergenic
1156862550 18:41855188-41855210 AAGTTTTGTCAGTATGATGTTGG + Intergenic
1157042537 18:44057828-44057850 ATGTGATGGCATTAGGAGGTTGG - Intergenic
1157532999 18:48438217-48438239 AAGTGATGGTATTAGGAGGTGGG + Intergenic
1157641936 18:49224509-49224531 AGGTGATGGTATTAGGAGGTGGG + Intronic
1158494977 18:57946840-57946862 AGGTGATGGTATTAGGAGGTGGG - Intergenic
1158789223 18:60755848-60755870 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1158876718 18:61741133-61741155 AAGTGATGATATTAGGAGATGGG - Intergenic
1158886837 18:61836383-61836405 ATGTGATGACATTTGGAGGTAGG + Intronic
1159248358 18:65839470-65839492 AGGTGATGCCATTAGGAGGTGGG - Intronic
1159934401 18:74350870-74350892 AGGTGATGATATTAGGAGGTAGG + Intronic
1161014762 19:1978179-1978201 CAGTGGTGTCATTTGGAGGGTGG + Intronic
1161168680 19:2802282-2802304 AGGTGTTGGTATTGGGAGGTGGG - Intronic
1161256540 19:3313096-3313118 ACGTGGTGTCATCAGGAAGTGGG + Intergenic
1163889745 19:20000246-20000268 CAGAGTTGTCTCTAGGAGGTGGG - Intronic
1164972281 19:32542836-32542858 AAGTGATGGTATGAGGAGGTGGG + Intergenic
1165127528 19:33610800-33610822 ATGTGGTGGCATTGGGAGGTGGG - Intergenic
1165882824 19:39055668-39055690 AGGTGATGGTATTAGGAGGTGGG - Intergenic
1166583531 19:43925017-43925039 ATGTGATGTTATTGGGAGGTGGG + Intronic
924973422 2:152045-152067 ATCTGTTGTCATTTTGAGGTAGG + Intergenic
925038463 2:710577-710599 AAGTGATGGTATTAGGAGGTGGG + Intergenic
925320188 2:2960145-2960167 AGGTAATGGCATTAGGAGGTGGG - Intergenic
925432011 2:3802702-3802724 AAGTGATGATATTAGGAGGCTGG - Intronic
925642481 2:5999278-5999300 ATGTGATGGTATTAGGAGGTGGG - Intergenic
925799385 2:7583109-7583131 AACTGATGGTATTAGGAGGTGGG - Intergenic
925833815 2:7923223-7923245 AAGTGGTGGTATTAGGAGGTGGG - Intergenic
925880660 2:8349734-8349756 ATGTGATGGTATTAGGAGGTGGG - Intergenic
926097201 2:10089345-10089367 GTGTGTTGGCATTAGGAGGTGGG + Intergenic
926573325 2:14553706-14553728 ATGTGATGGTATTAGGAGGTGGG + Intergenic
926582588 2:14647528-14647550 AAGTGATGATATTAGGAGATGGG + Intronic
927292950 2:21422475-21422497 ATGTGATGATATTAGGAGGTGGG + Intergenic
928044715 2:27917624-27917646 ATGTGTTGGTATTAAGAGGTAGG - Intronic
928168073 2:28985079-28985101 ATGTGTTGGTATTAGGAGGTGGG + Intronic
928439997 2:31284431-31284453 ATGTGATGGTATTAGGAGGTGGG + Intergenic
928611790 2:32998633-32998655 ATGTGATGGTATTAGGAGGTGGG + Intronic
928653095 2:33422471-33422493 AAGTGATGGGATTAGAAGGTGGG + Intergenic
928765970 2:34646005-34646027 ATGTGTTGGTATTAAGAGGTAGG - Intergenic
929448160 2:42016411-42016433 AGGTGATGGTATTAGGAGGTGGG - Intergenic
929895306 2:45954905-45954927 AAGTATTGACAATAGTAGGTAGG - Intronic
930194855 2:48499075-48499097 AGGTGATGGTATTAGGAGGTAGG - Intronic
930683689 2:54285206-54285228 ATGTGTTGTTATTAAGAGATAGG - Intronic
930878463 2:56245711-56245733 ATGTGATGGTATTAGGAGGTGGG + Intronic
930924359 2:56798770-56798792 ATGTGATGTCATTTGGAGATGGG + Intergenic
931945758 2:67305515-67305537 ATGTGATGACATTAGGAGATGGG + Intergenic
932012056 2:67988489-67988511 AGGTGATGGTATTAGGAGGTTGG - Intergenic
932362270 2:71118726-71118748 AAGTGATGGTGTTAGGAGGTGGG - Intronic
932855732 2:75232315-75232337 ATGTGTTGGTATTAGAAGGTGGG - Intergenic
933020876 2:77189438-77189460 ATGTGATGTTATTAGAAGGTGGG + Intronic
933140733 2:78790020-78790042 AAGTGTTGTCATTTGAAGGAGGG + Intergenic
933180648 2:79222768-79222790 ATGTGATGGCATTAGGAGGTGGG + Intronic
933505686 2:83174593-83174615 AGGTGATATTATTAGGAGGTTGG - Intergenic
933589811 2:84219750-84219772 ATGTGATGTTATTAAGAGGTGGG - Intergenic
933613465 2:84460270-84460292 AAATATTGTCATTAACAGGTTGG + Intergenic
933993774 2:87652573-87652595 CAGTGAGGGCATTAGGAGGTGGG - Intergenic
934014254 2:87862254-87862276 ATGTGATGGTATTAGGAGGTAGG + Intergenic
934546721 2:95223903-95223925 AGGTGATGGCATTAGGAGATGGG + Intronic
935448443 2:103181488-103181510 ATGTGATGGTATTAGGAGGTGGG - Intergenic
935495658 2:103777600-103777622 AAGTGGTGGTATTGGGAGGTGGG + Intergenic
935740668 2:106144838-106144860 CAGTGATGGTATTAGGAGGTGGG - Intronic
935745249 2:106184710-106184732 AAGTGATGGCATTAAGAGGTGGG - Intronic
935758113 2:106293392-106293414 ATGTGATGGTATTAGGAGGTGGG + Intergenic
935813456 2:106823947-106823969 AGGTGATGTTATTAGGAGGTGGG - Intronic
936300089 2:111298310-111298332 CAGTGAGGGCATTAGGAGGTGGG + Intergenic
936396704 2:112137251-112137273 AGATGATGGCATTAGGAGGTGGG + Intergenic
936633105 2:114225990-114226012 AAGTGTAGTAATTAGGAGTGGGG - Intergenic
937253116 2:120536516-120536538 AGGTGATGGTATTAGGAGGTGGG + Intergenic
937420262 2:121748266-121748288 AAGTGATGTTATTAGGAGGTAGG + Intronic
937653197 2:124344103-124344125 ATGTGTTTGCATTGGGAGGTGGG - Intronic
938778297 2:134560963-134560985 AAGTTTTGTCATTAAAAGCTGGG - Intronic
938928661 2:136066912-136066934 AAGTGATGGTATTAGGAGGTGGG + Intergenic
939521131 2:143231961-143231983 GTGTGATGCCATTAGGAGGTAGG - Intronic
939868876 2:147505484-147505506 AAGTTTTTTCATTGGCAGGTAGG + Intergenic
939877756 2:147597335-147597357 AAGTGATGATATCAGGAGGTGGG + Intergenic
940307228 2:152239571-152239593 AAGTGATCGTATTAGGAGGTAGG + Intergenic
940411420 2:153368200-153368222 AAGTGGTGGTATTAGGAGGTGGG + Intergenic
941349873 2:164418881-164418903 AGGTGATGGCATTAGGACGTGGG - Intergenic
941364180 2:164590052-164590074 ATGTGATGGCATTAGGATGTGGG - Intronic
941966220 2:171303578-171303600 AAGTGATGGTATTAGAAGGTGGG + Intergenic
942287349 2:174433574-174433596 ATGTGTTAGTATTAGGAGGTAGG + Exonic
942812714 2:180017520-180017542 AGGTGATGGTATTAGGAGGTGGG + Intergenic
943044638 2:182845404-182845426 AACTTGTGCCATTAGGAGGTTGG - Intronic
943212571 2:184987209-184987231 AAGTGGTGGCATTGAGAGGTGGG + Intergenic
943389330 2:187244157-187244179 ATGTGATGGTATTAGGAGGTGGG - Intergenic
943517226 2:188904304-188904326 AGGTAATGGCATTAGGAGGTGGG + Intergenic
943944074 2:194036144-194036166 AAGTGATGGTGTTAGGAGGTGGG + Intergenic
943990258 2:194680600-194680622 AGGTGATGGTATTAGGAGGTAGG - Intergenic
944154636 2:196596449-196596471 ATGTGATGGTATTAGGAGGTGGG + Intergenic
945451946 2:210003911-210003933 AAGTTTTGTCATTATCAGTTGGG - Intronic
945515259 2:210756017-210756039 TAGTGTTTTTATTAGGCGGTTGG + Intergenic
945568525 2:211434308-211434330 AAGTGATGGTGTTAGGAGGTGGG + Intronic
945603370 2:211895219-211895241 AAGTGTTGTCATAAGGTGAGAGG - Intronic
945930741 2:215852656-215852678 AGGTGGTGGTATTAGGAGGTGGG - Intergenic
945935202 2:215896873-215896895 CAGTGATGGTATTAGGAGGTGGG - Intergenic
945985881 2:216353119-216353141 AAGTGTTGTCATTTGAAGTTAGG - Intronic
946045883 2:216820623-216820645 AAGTGATGGTATTAGAAGGTGGG + Intergenic
946120501 2:217508889-217508911 AGGTGGTGGCATTAGGAGGTGGG + Intronic
946909792 2:224448305-224448327 ATGTGATGGTATTAGGAGGTAGG + Intergenic
947181731 2:227417276-227417298 AGGTGATGGTATTAGGAGGTGGG + Intergenic
947358898 2:229326302-229326324 AAGTGATGATATTAGGAGGTAGG + Intergenic
947386405 2:229595086-229595108 AAGTATTGTGAATAGCAGGTAGG - Intronic
947647563 2:231754966-231754988 ATGTGATGGTATTAGGAGGTGGG + Intronic
948017235 2:234700701-234700723 AGGTGATGGTATTAGGAGGTGGG - Intergenic
948154434 2:235770076-235770098 ATGTGTTATTACTAGGAGGTGGG - Intronic
948735437 2:240001150-240001172 CACGGTTGTCTTTAGGAGGTGGG + Intronic
1168884171 20:1233756-1233778 ATGTGATGGTATTAGGAGGTGGG - Intronic
1169408532 20:5347181-5347203 ATGTGGTGGTATTAGGAGGTGGG - Intergenic
1169603862 20:7293279-7293301 ATGTGATATTATTAGGAGGTGGG + Intergenic
1169713445 20:8589996-8590018 AAGTGATGATATTAGGAGGAGGG - Intronic
1170148717 20:13205689-13205711 ATGTGATGGCATTCGGAGGTGGG - Intergenic
1171084419 20:22224260-22224282 AGGTGATGGTATTAGGAGGTGGG - Intergenic
1172784441 20:37457731-37457753 AGGTGATGGTATTAGGAGGTGGG - Intergenic
1173180596 20:40803741-40803763 AGGTGATGGCATTGGGAGGTGGG - Intergenic
1173334839 20:42104086-42104108 ATGTGATGGTATTAGGAGGTTGG + Intronic
1173395315 20:42673719-42673741 AAATGATGATATTAGGAGGTGGG - Intronic
1173542005 20:43860749-43860771 AAGTGATGGTATTAAGAGGTTGG - Intergenic
1173946381 20:46954108-46954130 AAGTGATGTGAAGAGGAGGTAGG - Intronic
1174189314 20:48728985-48729007 ACGTGCTGCCATTAGGAGGTTGG - Intronic
1174456200 20:50650266-50650288 CCGTGCTGTGATTAGGAGGTGGG - Intronic
1174645939 20:52085383-52085405 AAGTGTTGTCATTAGGAGGTTGG - Intronic
1174851927 20:54004108-54004130 ATGTGATGGTATTAGGAGGTGGG + Intronic
1175323973 20:58109926-58109948 ATGTGATGCTATTAGGAGGTGGG + Intergenic
1175465396 20:59187258-59187280 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1176369306 21:6052843-6052865 AAGCAGTGGCATTAGGAGGTGGG + Intergenic
1176702550 21:10073198-10073220 ATGTGTTAGCATTTGGAGGTGGG + Intergenic
1176798168 21:13390666-13390688 AGGTGATGTTATTAGGAGGTAGG + Intergenic
1176881917 21:14204977-14204999 AAGTGTTTTCAATATAAGGTAGG + Intronic
1176937291 21:14882093-14882115 AGGTGATGGTATTAGGAGGTAGG - Intergenic
1177260005 21:18717601-18717623 AGGTGATGCTATTAGGAGGTGGG - Intergenic
1177934536 21:27327542-27327564 AGGTGATGGTATTAGGAGGTGGG - Intergenic
1178066792 21:28913362-28913384 ATGTGATGGTATTAGGAGGTGGG - Intergenic
1178142215 21:29697414-29697436 AAGTGTTTTCATTATGTGCTTGG + Intronic
1178163632 21:29946971-29946993 ATGTGCTGTCATGAGGAGTTGGG - Intergenic
1178169359 21:30021449-30021471 AAGTGATGATATTAAGAGGTGGG + Intergenic
1178222863 21:30680887-30680909 AAGTGATAGTATTAGGAGGTAGG - Intergenic
1178237521 21:30859603-30859625 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1178348522 21:31852549-31852571 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1178711943 21:34925000-34925022 ATGTGATGGTATTAGGAGGTGGG - Intronic
1179058836 21:37960660-37960682 AGGTGATGATATTAGGAGGTGGG - Intronic
1179240704 21:39588670-39588692 AGGTGATGGTATTAGGAGGTGGG - Intronic
1179754213 21:43485698-43485720 AAGCAGTGGCATTAGGAGGTGGG - Intergenic
1182835898 22:33341097-33341119 AGGTGATGACATTAGGAGGTGGG + Intronic
1183039165 22:35163416-35163438 AGGTGGTGGTATTAGGAGGTGGG - Intergenic
1183242558 22:36668757-36668779 AAGTGCTGGGATTACGAGGTGGG + Intronic
1183752721 22:39731177-39731199 ATGTGATGACATTAGGAGGTGGG + Intergenic
1183761367 22:39821938-39821960 AAGTGATGGTATTAGGAGGCGGG - Intronic
1184722897 22:46325724-46325746 AGGTGATGGCATTAGAAGGTGGG - Intronic
1185076593 22:48686500-48686522 AAGTGATGGTATTAGGAAGTGGG - Intronic
1185131683 22:49043073-49043095 AGGTGATGGTATTAGGAGGTGGG - Intergenic
1185152784 22:49175526-49175548 AGGTGGTGGTATTAGGAGGTGGG + Intergenic
1185389745 22:50552755-50552777 ACGTGATGGTATTAGGAGGTCGG + Intronic
949406076 3:3716253-3716275 ATGTGGTGCTATTAGGAGGTGGG - Intronic
949589889 3:5483096-5483118 AGGTGATGGTATTAGGAGGTGGG - Intergenic
949695350 3:6688348-6688370 AGGTGATGATATTAGGAGGTAGG - Intergenic
949786684 3:7749319-7749341 ACGTGATGTTATTAGGAGGCAGG + Intergenic
949830822 3:8212374-8212396 AAGTGATGGTATTAGGATGTGGG - Intergenic
949873583 3:8609260-8609282 AGGTGATGGCATTAGGACGTGGG - Intergenic
950567358 3:13778186-13778208 AGGTGATGGCATTAGGAGGTGGG + Intergenic
950798864 3:15533215-15533237 AAGTGATGGTATTAGGAGATAGG - Intergenic
950816033 3:15703390-15703412 AGGTGATGTTATTAGGAGGTGGG + Intronic
951084911 3:18500982-18501004 GTGTGATGACATTAGGAGGTGGG + Intergenic
951247849 3:20361742-20361764 AGGTGATGGTATTAGGAGGTGGG - Intergenic
951425469 3:22539647-22539669 AAGTGATAGTATTAGGAGGTTGG - Intergenic
951710531 3:25581652-25581674 ATGTGATGGTATTAGGAGGTGGG + Intronic
951934638 3:28008421-28008443 AGGTGATGGTATTAGGAGGTGGG + Intergenic
952271648 3:31838564-31838586 AAGTGATGCTATTAGGTGGTAGG + Intronic
952380225 3:32798704-32798726 AGGTGATGGTATTAGGAGGTAGG - Intergenic
952509802 3:34041721-34041743 ATGTGATGATATTAGGAGGTAGG + Intergenic
953239442 3:41135569-41135591 GTGTCTTGTCATTAAGAGGTAGG + Intergenic
953358072 3:42271205-42271227 ATGTGATGGTATTAGGAGGTGGG - Intergenic
953467586 3:43137086-43137108 AAGTGATGGTGTTAGGAGGTAGG - Intergenic
955294207 3:57720511-57720533 AGGTGATGTTATTAGGAGGTGGG - Intergenic
955517541 3:59742627-59742649 ATGTGATGGTATTAGGAGGTAGG - Intergenic
956230956 3:67016155-67016177 ATGTGATGGTATTAGGAGGTAGG - Intergenic
956571880 3:70705679-70705701 AAGTGATGGTATTAAGAGGTGGG - Intergenic
956582129 3:70825853-70825875 AAGTGATAGTATTAGGAGGTGGG + Intergenic
956891138 3:73615486-73615508 AAGTGATGGTATTAGCAGGTGGG + Intronic
956914665 3:73858677-73858699 ATGTGATGGTATTAGGAGGTGGG - Intergenic
957260138 3:77890218-77890240 AAGTGATGATATTAGGAGGTGGG - Intergenic
957311141 3:78520375-78520397 AAGTGATAACATTAAGAGGTGGG + Intergenic
957452968 3:80403282-80403304 AAGTGTTGGAATTAGGAAATGGG + Intergenic
957561842 3:81832394-81832416 AAATGATGACATTAGGAGGTGGG + Intergenic
957563398 3:81855081-81855103 AGGTGATGATATTAGGAGGTGGG - Intergenic
957882005 3:86228878-86228900 AAATGTTGTCATTGGTTGGTTGG + Intergenic
958068807 3:88582468-88582490 AGGGGTTATCATTAGGTGGTAGG + Intergenic
958196442 3:90247081-90247103 AAGTGTTGTGATTAGACTGTTGG - Intergenic
958717300 3:97800950-97800972 ATGTGATGATATTAGGAGGTGGG - Intronic
958859687 3:99431643-99431665 AAGTGATGATATTAGGAGATGGG + Intergenic
958891321 3:99786300-99786322 AAGTGATGGTATTAGGAGGTGGG + Intronic
959517887 3:107290332-107290354 ATGTGATGATATTAGGAGGTGGG + Intergenic
959524338 3:107359941-107359963 AAGTGATGGTATTAGGAGGTAGG + Intergenic
959770176 3:110085584-110085606 AGGTGATGGCATTAGGAGGTGGG + Intergenic
959995854 3:112679480-112679502 AGGTGATGGCATTAGGAGGTGGG - Intergenic
960029721 3:113045043-113045065 AGGTGATGATATTAGGAGGTGGG + Intergenic
960230459 3:115220173-115220195 AGTTGATGACATTAGGAGGTGGG - Intergenic
960374083 3:116877331-116877353 ATGTGATGATATTAGGAGGTTGG - Intronic
960653160 3:119974354-119974376 ATGTGATGGTATTAGGAGGTAGG + Intronic
960960934 3:123069727-123069749 AAGTGGTGGTGTTAGGAGGTGGG - Intronic
961251780 3:125513106-125513128 AGGTGATGGTATTAGGAGGTGGG + Intronic
962294196 3:134166145-134166167 AAGTGATGGTATTAGGAGTTGGG + Intronic
962434999 3:135358026-135358048 AAGTGATGTCATTAGAAGGGTGG + Intergenic
962557245 3:136566174-136566196 AAGTGATGGTATTAGAAGGTGGG + Intronic
963348710 3:144126877-144126899 AGGTGATGGTATTAGGAGGTGGG - Intergenic
963429281 3:145177194-145177216 AAGTTATGTCATTATTAGGTAGG - Intergenic
963712987 3:148768720-148768742 AGGTGATGGAATTAGGAGGTGGG + Intergenic
963842538 3:150122356-150122378 AGGTGATGGTATTAGGAGGTAGG + Intergenic
963958868 3:151285730-151285752 ATGTGTTGGTATTAAGAGGTGGG + Intronic
964865499 3:161255228-161255250 ATGTGATGGCATTAGGAGGTGGG - Intergenic
965297901 3:166973000-166973022 AAGTGATGTTATTAGAAAGTAGG - Intergenic
966010686 3:175072186-175072208 TAGTGTTGTGATTAGGAACTGGG + Intronic
966059832 3:175741390-175741412 AAGTGATGGTATTAGGAGGTAGG - Intronic
967395277 3:189001591-189001613 AAGTGATGATATTAAGAGGTAGG - Intronic
967863597 3:194172310-194172332 ATATGATGGCATTAGGAGGTGGG - Intergenic
969362084 4:6671366-6671388 ATGTGATGATATTAGGAGGTGGG - Intergenic
970158298 4:13163693-13163715 AGGTGATGGTATTAGGAGGTGGG + Intergenic
970343041 4:15126848-15126870 ATGTGATGGTATTAGGAGGTGGG + Intergenic
970376447 4:15462516-15462538 ATGTGATGGCATTTGGAGGTGGG + Intergenic
970879705 4:20914306-20914328 AGGTGATGGTATTAGGAGGTAGG + Intronic
971490106 4:27203207-27203229 ATGTGATGGCATTAGGAGGTGGG + Intergenic
971646591 4:29214155-29214177 ATGTGATGGTATTAGGAGGTGGG + Intergenic
971707238 4:30060974-30060996 AAGTGATGGTATTAAGAGGTGGG + Intergenic
972166010 4:36284941-36284963 AGGTGATGGTATTAGGAGGTGGG - Intronic
972312826 4:37896646-37896668 AAGTGTTTTCATGAGGAAGTTGG + Intronic
972377595 4:38487290-38487312 ATGTGATGGTATTAGGAGGTGGG - Intergenic
972624003 4:40778421-40778443 AAGTGATGGTATCAGGAGGTGGG + Intronic
972768668 4:42175150-42175172 AGGTGATGGCATTAGGAGGTGGG - Intergenic
973163931 4:47053517-47053539 ATGTGATGGCATTAGAAGGTGGG - Intronic
973186922 4:47340672-47340694 AGGTGATGACATTAAGAGGTTGG - Intronic
973247938 4:48030507-48030529 AGTTGTTCTAATTAGGAGGTGGG - Intronic
973659560 4:53088896-53088918 ATGTGCTGGCATTAGGAAGTGGG + Intronic
973792418 4:54390835-54390857 AAGTGTGGTCAGTAAGTGGTGGG - Intergenic
974015768 4:56647549-56647571 AGGTGGTGATATTAGGAGGTGGG - Intergenic
974249932 4:59372951-59372973 AATTGATGTTATTAGGAAGTGGG + Intergenic
974696481 4:65381716-65381738 AAGTGATGATTTTAGGAGGTAGG + Intronic
974843992 4:67329386-67329408 AAGTGATGATATTAGGAGGTCGG + Intergenic
974847393 4:67367347-67367369 AAGTGATGGCATTAGGAATTGGG + Intergenic
974849601 4:67388582-67388604 ATGTGATGGCATTAGGAGATGGG - Intergenic
974931082 4:68361728-68361750 AGGTGTTGGTATTAAGAGGTTGG - Intergenic
975468979 4:74743163-74743185 AAGTGATGTCCTGAGGTGGTGGG - Intergenic
975531846 4:75407572-75407594 AAGTGATAGTATTAGGAGGTAGG - Intergenic
975611275 4:76206016-76206038 AGGTGGTGAGATTAGGAGGTGGG + Intronic
976224828 4:82787640-82787662 AGGTGTTGGTATTAGGAGGTGGG + Intronic
976305174 4:83552802-83552824 AAGTGATGGTATTAGGAGGTGGG + Intronic
976318523 4:83685405-83685427 AAGGGATGGCATTATGAGGTGGG - Intergenic
976564574 4:86539044-86539066 CAGTGTTGTAGTTATGAGGTGGG + Intronic
977052002 4:92140217-92140239 AAGTGTAGTTCTTTGGAGGTAGG - Intergenic
977075819 4:92447852-92447874 AGGTGATGGTATTAGGAGGTGGG - Intronic
977112953 4:92983417-92983439 ATGTGATGACATTAAGAGGTGGG - Intronic
977201293 4:94119878-94119900 ATGTGATGGAATTAGGAGGTGGG - Intergenic
977306038 4:95324643-95324665 AGGTGATGGTATTAGGAGGTGGG + Intronic
977406704 4:96608684-96608706 AAGTGATGGTATTTGGAGGTGGG - Intergenic
978109602 4:104946966-104946988 AGGTGATGACATTAGGAGGTGGG + Intergenic
978595431 4:110372722-110372744 ATGTAATGGCATTAGGAGGTGGG - Intronic
978752857 4:112271900-112271922 AAGTGTTGACATTTAGAAGTTGG + Intergenic
978869254 4:113555818-113555840 AAGTGCTGATATTAGGAGGTGGG + Intronic
979439230 4:120731622-120731644 AAGTGTGGTCATGTGGAAGTTGG + Intronic
979901233 4:126221146-126221168 AGGTGTTGGTATTAGAAGGTAGG - Intergenic
979955422 4:126948293-126948315 AAGTGATGGTGTTAGGAGGTAGG + Intergenic
980374723 4:131929652-131929674 ACGTGTTAGCATTTGGAGGTGGG + Intergenic
980603915 4:135064392-135064414 AGGTGATGGTATTAGGAGGTGGG + Intergenic
980731973 4:136835486-136835508 AAGTGATGGTAGTAGGAGGTGGG + Intergenic
980852263 4:138396949-138396971 ATGTGATGGTATTAGGAGGTAGG + Intergenic
980995901 4:139779345-139779367 AAGTGTTATCATCAGGTGGCTGG + Intronic
981206701 4:142049799-142049821 GAGTTTTGTCATTATGTGGTGGG + Intronic
981301585 4:143192713-143192735 GTGTGTTGGCATTAAGAGGTGGG - Intronic
981338936 4:143598097-143598119 AGGTGATAGCATTAGGAGGTGGG - Intronic
981445501 4:144832755-144832777 ATGTGATGGTATTAGGAGGTGGG + Intergenic
981628095 4:146784479-146784501 AGGTGATGATATTAGGAGGTGGG + Intronic
981665114 4:147215444-147215466 AAGTGATGGTATTAGGAGGTGGG + Intergenic
981903875 4:149896934-149896956 AAGTGATGATATTAGGAGGCGGG + Intergenic
981917565 4:150051570-150051592 AGGTGATGGTATTAGGAGGTGGG + Intergenic
982304448 4:153915663-153915685 ATGTGGTGGTATTAGGAGGTGGG + Intergenic
982401787 4:154976247-154976269 AGGTGATGCCGTTAGGAGGTGGG - Intergenic
982431524 4:155327238-155327260 ATGTGATGGGATTAGGAGGTGGG - Intergenic
982536570 4:156614284-156614306 AAGTGATGGTCTTAGGAGGTGGG + Intergenic
983124288 4:163931373-163931395 AAGTGATGACATTAGTATGTGGG + Intronic
983125005 4:163939964-163939986 ATGTGATGGTATTAGGAGGTGGG + Intronic
983427602 4:167606920-167606942 ATGTGATGGCATTAGGAGGTGGG - Intergenic
983473534 4:168186415-168186437 AAGTGATGATACTAGGAGGTGGG + Intronic
983672308 4:170252411-170252433 ATGTGATGGTATTAGGAGGTGGG + Intergenic
983993935 4:174158597-174158619 ATGTGCTGGTATTAGGAGGTGGG - Intergenic
985150530 4:186942779-186942801 AGGTGATGGTATTAGGAGGTGGG + Intergenic
985289750 4:188375673-188375695 AGGTGATGGCATTAGGAGGCGGG + Intergenic
985934692 5:3088008-3088030 GTGTGATGGCATTAGGAGGTGGG - Intergenic
985935062 5:3091188-3091210 ATGTGTTCTCATTAGGAGGAAGG + Intergenic
986256373 5:6104218-6104240 ATGTGATGGTATTAGGAGGTGGG - Intergenic
986260850 5:6145115-6145137 ATGTGATGTCATTAGAAGGCAGG - Intergenic
986549503 5:8936672-8936694 TAGTGTGGTCATTTGGAGGTAGG - Intergenic
986673926 5:10167495-10167517 AAGTGATGGTATCAGGAGGTAGG - Intergenic
986798850 5:11239503-11239525 AAGAGTGGTGATTGGGAGGTGGG - Intronic
987175367 5:15302551-15302573 ATGTGATGGCATTTGGAGGTGGG + Intergenic
987225671 5:15838452-15838474 ATGTTATGGCATTAGGAGGTGGG - Intronic
987466074 5:18273467-18273489 ATGTGATGATATTAGGAGGTGGG - Intergenic
987650976 5:20739694-20739716 AAATGATGGTATTAGGAGGTGGG - Intergenic
987665047 5:20926508-20926530 AATTGTGGTCATTAGAAGTTGGG - Intergenic
987795032 5:22616781-22616803 ATGTGATGGTATTAGGAGGTAGG + Intronic
988172398 5:27675710-27675732 AAGTGATGGTATTAGGAGGTGGG + Intergenic
988220855 5:28345367-28345389 ATATGTTGGTATTAGGAGGTGGG - Intergenic
988330521 5:29833084-29833106 AAGTGTAGTCACCAGGAGCTAGG - Intergenic
988734407 5:34006628-34006650 AGGTCTTGTAATTAGGAGGAAGG - Intronic
988757640 5:34275651-34275673 AATTGTGGTCATTAGAAGTTGGG + Intergenic
989182614 5:38593679-38593701 ATGTGATGGCATTAGCAGGTGGG + Intronic
989225723 5:39025790-39025812 ACGTATTGGTATTAGGAGGTGGG - Intronic
989565894 5:42900560-42900582 GAGTGCTGTCCTTAGGAAGTGGG + Intergenic
989728805 5:44623091-44623113 ATGTGATGATATTAGGAGGTGGG + Intergenic
990055586 5:51572780-51572802 AAGTGATGACATTAGGAGGTAGG - Intergenic
990115708 5:52388031-52388053 AGGTGATGTTATTAAGAGGTGGG - Intergenic
990687896 5:58328290-58328312 AAGTGATGGTATTAAGAGGTGGG + Intergenic
990755677 5:59066720-59066742 ATGTGATGGTATTAGGAGGTGGG + Intronic
990841275 5:60082180-60082202 GTGTGATGACATTAGGAGGTAGG + Intronic
990971479 5:61511498-61511520 AGGTGATGGCATTAGGAGTTGGG + Intronic
991027932 5:62051395-62051417 TAGTGTGGTCATTTGGAGGTAGG + Intergenic
991292960 5:65050553-65050575 ATGTGATGGTATTAGGAGGTGGG - Intergenic
991504103 5:67306173-67306195 AAATGTTGGCACTAGGATGTAGG + Intergenic
991559441 5:67933968-67933990 AGGTGATGGTATTAGGAGGTGGG + Intergenic
991953729 5:71971832-71971854 AGGTGATGGTATTAGGAGGTGGG - Intergenic
992107703 5:73463701-73463723 ATGTGATGGTATTAGGAGGTGGG + Intergenic
992157948 5:73973181-73973203 AGGTGATGGTATTAGGAGGTGGG - Intergenic
992442510 5:76809128-76809150 AGTTGTTGTGATTAGGAGGAAGG - Intergenic
992578103 5:78140631-78140653 ATGTGATGGTATTAGGAGGTAGG - Intronic
992646950 5:78819955-78819977 AGGTGATGGCATTAAGAGGTGGG + Intronic
992778540 5:80108252-80108274 AAGTGATGGCATAAGGAGGTGGG + Intergenic
993481879 5:88434001-88434023 AAGTTTTGTGACTAGGGGGTGGG - Intergenic
993552314 5:89288766-89288788 ATGTGTTGGTATTAAGAGGTGGG + Intergenic
993769216 5:91904069-91904091 ATGTGATGGCATTAGAAGGTGGG + Intergenic
993978338 5:94510989-94511011 AGGTGGTGGCATTTGGAGGTAGG + Intronic
994518420 5:100798727-100798749 AGGTGATGTTATTATGAGGTGGG - Intergenic
995065002 5:107851582-107851604 AAGTGATGGTATTAGGAGGTGGG + Intergenic
995217094 5:109607926-109607948 ATGTGATGATATTAGGAGGTGGG + Intergenic
995368358 5:111389289-111389311 ATGTGATGTTATTAGGAGGTGGG - Intronic
995773497 5:115699222-115699244 ATGTGATGGTATTAGGAGGTGGG + Intergenic
995974910 5:118022572-118022594 ATGTGATGGCATTAGGAGGTGGG + Intergenic
996178285 5:120387206-120387228 AAGTGATGTTATTAAGAGGTGGG - Intergenic
996424866 5:123303791-123303813 ATGTGATGGCAGTAGGAGGTGGG - Intergenic
996428301 5:123339528-123339550 ATGTGATGATATTAGGAGGTGGG - Intergenic
996962176 5:129264363-129264385 CCTTATTGTCATTAGGAGGTGGG - Intergenic
997119188 5:131156745-131156767 ATGTGATGGTATTAGGAGGTGGG - Intergenic
997159390 5:131591629-131591651 AAGTATTGTCATGAGGTGTTAGG - Intronic
997922953 5:137999914-137999936 AAGTTTTGGTATTAGGAAGTGGG - Intronic
997998608 5:138606379-138606401 ACTTGTTGTCATCAGGAGGTGGG + Intergenic
998002689 5:138637300-138637322 ATGTGATGATATTAGGAGGTGGG + Intronic
998195470 5:140065968-140065990 AGGTGATGGTATTAGGAGGTGGG + Intergenic
998806335 5:145920796-145920818 AGGTGATGTTATTAGGAGGCAGG + Intergenic
999364674 5:151014442-151014464 AAGTGATGCTATTAGGAGGTGGG + Intergenic
999950294 5:156642214-156642236 ATGTGATGGTATTAGGAGGTGGG - Intronic
1000050368 5:157557837-157557859 AGGTGATGGTATTAGGAGGTGGG - Intronic
1000166467 5:158653872-158653894 ACGTGATGGCATTTGGAGGTGGG - Intergenic
1001195136 5:169666284-169666306 ATGTGATGGCATTAGGAGGTGGG - Intronic
1001251696 5:170151879-170151901 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1001453166 5:171841665-171841687 AAGTGATGGTATTTGGAGGTGGG - Intergenic
1001738065 5:174023247-174023269 AAGTGATGGTATTAGGAGGTGGG - Intergenic
1001867986 5:175122244-175122266 AAGTGATGGTATTAGGAGGTGGG + Intergenic
1001871163 5:175157190-175157212 AAGTGATGCTATTAGGAGATGGG + Intergenic
1001900275 5:175421227-175421249 ATGTGATGGAATTAGGAGGTGGG + Intergenic
1002884263 6:1280159-1280181 ATGTGGTGGTATTAGGAGGTGGG + Intergenic
1003191321 6:3877842-3877864 AGGTGATGGTATTAGGAGGTGGG - Intergenic
1003435450 6:6083923-6083945 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1003613006 6:7630226-7630248 AGGTGATGGCATGAGGAGGTGGG + Intergenic
1003636031 6:7832293-7832315 AGGTGATGGTATTAGGAGGTGGG + Intronic
1003674335 6:8189143-8189165 ATGTGATGGTATTAGGAGGTGGG - Intergenic
1003709703 6:8575724-8575746 AAGTGATGGTATTAGGAGGTGGG - Intergenic
1003780406 6:9418139-9418161 AAGTGTAGTCATTTGGACTTAGG + Intergenic
1003946196 6:11078170-11078192 ATGTGATGGCATTAGGAAGTGGG + Intergenic
1003980897 6:11388823-11388845 AGGTGTTATTATTAGGAAGTGGG + Intergenic
1004067591 6:12264224-12264246 AAGGGTTGTGACTAGGAGCTTGG + Intergenic
1004241976 6:13931839-13931861 AGGTGATGGTATTAGGAGGTAGG + Intronic
1004373951 6:15075912-15075934 GCGTGTTGTAATTTGGAGGTGGG - Intergenic
1004605685 6:17193077-17193099 AAATGATGGTATTAGGAGGTAGG - Intergenic
1004618700 6:17314482-17314504 ATGTGATGGAATTAGGAGGTGGG + Intergenic
1004759805 6:18654228-18654250 ATGTGTTGGTATTAGGAGGTGGG + Intergenic
1005121657 6:22396736-22396758 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1005660240 6:27990863-27990885 AAGTGTTGGTATTAGGAGATGGG - Intergenic
1006433230 6:34011170-34011192 AAGTGGTGGTATTAGGAGGTGGG - Intergenic
1006906286 6:37535859-37535881 AGGTGTTTTCATTAGGACTTGGG - Intergenic
1007364340 6:41380575-41380597 AGGTGATGGCATTAGGAGGTGGG - Intergenic
1007459865 6:42010210-42010232 AAGTGTTGTCATGAGAAGAGAGG - Intronic
1007687850 6:43677608-43677630 TAGTGTAGTCATTAGGAGCATGG + Intronic
1007878414 6:45133962-45133984 ATGTGATGTTATTAAGAGGTGGG + Intronic
1008026040 6:46636971-46636993 AGGTGATGTCATTAGGAGGTGGG + Intronic
1008689210 6:53958773-53958795 ACGTGATGGTATTAGGAGGTAGG - Intronic
1009744568 6:67796646-67796668 ATGTGATGGCATTTGGAGGTGGG + Intergenic
1009757064 6:67953697-67953719 ATGTGATGTTATTAGAAGGTGGG + Intergenic
1009882828 6:69590717-69590739 ATGTGTTGATATTTGGAGGTGGG - Intergenic
1009987249 6:70795601-70795623 ATGTGATATTATTAGGAGGTGGG - Intronic
1010423509 6:75700885-75700907 AAGTGATGAAATGAGGAGGTTGG + Intronic
1010628566 6:78168898-78168920 ATGTGATGATATTAGGAGGTAGG + Intergenic
1010924651 6:81729508-81729530 AGGTGATGGCATTAGGAGGTAGG + Intronic
1011156868 6:84342960-84342982 AGGTGGTGGTATTAGGAGGTGGG - Intergenic
1011574901 6:88786834-88786856 ATGTGATGGTATTAGGAGGTGGG + Intronic
1012152698 6:95774839-95774861 ATGTGATGGCATTAGAAGGTGGG + Intergenic
1012365157 6:98429832-98429854 AAGCGATGGTATTAGGAGGTGGG + Intergenic
1012785280 6:103617300-103617322 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1012926644 6:105274385-105274407 AAGTGATGGAATTAGGAGGCAGG - Intergenic
1013224340 6:108109284-108109306 ATGTGATGGCATTAAGAGGTGGG - Intronic
1013398272 6:109766055-109766077 AATGGTTGGTATTAGGAGGTGGG + Intronic
1013626750 6:111945531-111945553 ATGTGATGGCATCAGGAGGTGGG - Intergenic
1013787646 6:113799617-113799639 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1014381073 6:120743194-120743216 AGGTGGTGGCATTAGAAGGTAGG + Intergenic
1014613698 6:123576654-123576676 AGGTGATGGCATTAGGAGTTGGG - Intronic
1014885991 6:126781893-126781915 AAGTGATGGTATTAGGAGGTAGG - Intergenic
1015307451 6:131725526-131725548 AGGTGATGGTATTAGGAGGTGGG - Intronic
1015613343 6:135049361-135049383 AGGTGATGGTATTAGGAGGTGGG - Intronic
1015656536 6:135525040-135525062 AGGTGATGGTATTAGGAGGTGGG + Intergenic
1015948756 6:138530109-138530131 ATGTGATGGTATTAGGAGGTGGG + Intronic
1016242739 6:141951501-141951523 AAGAGTTGTCAACAGGAGGCAGG - Intergenic
1016439805 6:144071273-144071295 AAGTGATGGTATTAGGAAGTGGG + Intergenic
1016546929 6:145234305-145234327 AAGTAATGGTATTAGGAGGTGGG - Intergenic
1016734315 6:147459999-147460021 ATGTGTTGGTATTTGGAGGTGGG + Intergenic
1016777877 6:147925122-147925144 ATGTGTTGGTATTAGGAGATGGG + Intergenic
1017904290 6:158746196-158746218 ATGTGATGGTATTAGGAGGTAGG - Intronic
1018782215 6:167078407-167078429 AAGGGATGCTATTAGGAGGTGGG - Intergenic
1019767800 7:2864237-2864259 AAGTTTTGTAACTAGGAGGTAGG + Intergenic
1020684220 7:11273496-11273518 AGGTGATGGTATTAGGAGGTGGG - Intergenic
1020690936 7:11353783-11353805 AAGTGATGCCATTTGGAAGTTGG + Intergenic
1020907231 7:14078474-14078496 ATGTGATGGCATTTGGAGGTGGG - Intergenic
1020981047 7:15069585-15069607 AAGTGATGGTATTAGGAAGTGGG - Intergenic
1021254776 7:18377302-18377324 ATGTGATGGTATTAGGAGGTGGG - Intronic
1021365862 7:19776984-19777006 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1021824050 7:24530111-24530133 AGGTGATGATATTAGGAGGTGGG - Intergenic
1021857675 7:24873363-24873385 AAGGGTTCTCATTACCAGGTGGG - Intronic
1022533808 7:31083493-31083515 AAGTGTTGTCTTTCAGAGTTTGG - Intronic
1022864004 7:34398504-34398526 ATGTGATGGCACTAGGAGGTAGG - Intergenic
1022955136 7:35373801-35373823 ATGTGATGATATTAGGAGGTGGG - Intergenic
1022958459 7:35402463-35402485 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1023572663 7:41588464-41588486 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1023855712 7:44182422-44182444 TACCCTTGTCATTAGGAGGTAGG + Intronic
1023900711 7:44476361-44476383 AAGTAATGTTATTTGGAGGTGGG + Intronic
1023988855 7:45115877-45115899 AAGTGTTGATATTAAGAGGTGGG + Intergenic
1024202025 7:47117495-47117517 AGGTGATGGCATTAGAAGGTGGG + Intergenic
1024577606 7:50777346-50777368 ACGTGATGTTATTAAGAGGTGGG - Intronic
1024701689 7:51910436-51910458 ATGTGATGGCATTAGGAGGCAGG - Intergenic
1026122468 7:67549921-67549943 AGGTGATGGCGTTAGGAGGTGGG - Intergenic
1026293052 7:69026019-69026041 AAATATTGTCATAAGGAGGTGGG - Intergenic
1026425053 7:70282601-70282623 AGGTGATGGTATTAGGAGGTGGG - Intronic
1027547191 7:79542357-79542379 AAGTGATGGTATTAGGAGGTGGG + Intergenic
1027701567 7:81476381-81476403 ATGTGATGATATTAGGAGGTAGG - Intergenic
1028047407 7:86139895-86139917 AACTGTTATTATTAGGAGGCAGG + Intergenic
1029027752 7:97435452-97435474 AAGTGTTTTCATTTGGAAGAGGG + Intergenic
1029892922 7:103950226-103950248 AAGTGATGGTATTAGGAAGTAGG - Intronic
1030353528 7:108518185-108518207 AAGTGATGGTATTAAGAGGTAGG - Exonic
1030511311 7:110485798-110485820 ATATGATGTTATTAGGAGGTGGG + Intergenic
1030605212 7:111633039-111633061 AAGTGTTGGCTTTAGTGGGTGGG + Intergenic
1030605975 7:111639517-111639539 AGGTGATGGCATTAGGAGGTGGG + Intergenic
1031016180 7:116579037-116579059 AGGTGATGATATTAGGAGGTGGG - Intergenic
1031053150 7:116965906-116965928 AAGTGTAGTGATGAGCAGGTTGG + Exonic
1031516987 7:122712925-122712947 AGGTGATGGTATTAGGAGGTGGG - Intronic
1032363221 7:131275317-131275339 AGGTGATGGTATTAGGAGGTGGG - Intronic
1033138927 7:138808012-138808034 AGGTGATGGCATTTGGAGGTGGG - Intronic
1033805066 7:144944565-144944587 ATGTGATGGTATTAGGAGGTGGG - Intergenic
1033876363 7:145823388-145823410 AAGTGATGGTATTAGGAAGTGGG - Intergenic
1033889329 7:145990279-145990301 ATGTGATATTATTAGGAGGTAGG + Intergenic
1034232043 7:149537999-149538021 AGGTGATGGTATTAGGAGGTGGG + Intergenic
1034362230 7:150510200-150510222 AAGTGATGGTATTAAGAGGTAGG + Intergenic
1034407084 7:150911786-150911808 AAGTGTTGTAATTAGCAAATGGG - Intergenic
1035563069 8:622312-622334 AGGTGATGTTATTAGGAGGTGGG + Intronic
1035830358 8:2688624-2688646 AAGTGTTGGTATTAGGAGGCTGG - Intergenic
1036161480 8:6392940-6392962 AACTGATGGCACTAGGAGGTGGG + Intergenic
1036913396 8:12779817-12779839 AATTGTAGTCATTAGAAGCTGGG - Intergenic
1037128121 8:15374438-15374460 AAGAGTTGTCATGAGGAAGAAGG - Intergenic
1037188529 8:16093804-16093826 GTGTAATGTCATTAGGAGGTGGG - Intergenic
1037626815 8:20615368-20615390 AAGTGATGGTGTTAGGAGGTAGG - Intergenic
1038234879 8:25743051-25743073 AAGTGCTGTTATTTGGTGGTAGG - Intergenic
1038431387 8:27503010-27503032 AGGTGATGTTATTAAGAGGTGGG + Intronic
1038491855 8:27977216-27977238 AAGTGATGGGACTAGGAGGTGGG - Intronic
1038680498 8:29662890-29662912 AAGAGATGGTATTAGGAGGTGGG - Intergenic
1038888101 8:31688230-31688252 AAGTGATGGTATTAAGAGGTAGG + Intronic
1038937880 8:32272386-32272408 ATGTGTTGATATTTGGAGGTGGG - Intronic
1039029692 8:33295986-33296008 ATGTGATGATATTAGGAGGTGGG - Intergenic
1040389225 8:46935340-46935362 AAGTGATGGTATTAGGAAGTGGG + Intergenic
1040588535 8:48766981-48767003 AAGTGATGGTATTAGGAGGTGGG + Intergenic
1040871481 8:52104150-52104172 AGGTGATGATATTAGGAGGTGGG + Intergenic
1041036773 8:53799695-53799717 AGGTGATGGTATTAGGAGGTGGG + Intronic
1041040934 8:53845134-53845156 AGGTGATGATATTAGGAGGTGGG - Intergenic
1041316663 8:56570514-56570536 AGGTGATGGTATTAGGAGGTGGG + Intergenic
1041748063 8:61231004-61231026 AGGTGATGGTATTAGGAGGTGGG - Intronic
1042117349 8:65446838-65446860 AGATGATGGCATTAGGAGGTGGG + Intergenic
1043011660 8:74888609-74888631 AAGTGATGGTATTAGAAGGTAGG - Intergenic
1043065549 8:75566298-75566320 GAGTGATGGTATTAGGAGGTGGG - Exonic
1044064425 8:87682196-87682218 ATGTGATGGCATTAGGAGGTGGG + Intergenic
1044220690 8:89665528-89665550 AGGTGCTGGTATTAGGAGGTGGG + Intergenic
1044646138 8:94445289-94445311 AGGTGGTGATATTAGGAGGTAGG - Intronic
1044926288 8:97211547-97211569 AGGTGATGGTATTAGGAGGTGGG - Intergenic
1045030121 8:98127200-98127222 AGGTGATGGTATTAGGAGGTGGG - Intronic
1045399263 8:101795605-101795627 AAGTGATGGTGTTAGGAGGTGGG - Intronic
1045495679 8:102706352-102706374 AGGTGATGGTATTAGGAGGTAGG + Intergenic
1046357839 8:113111051-113111073 TAGTGATGATATTAGGAGGTTGG - Intronic
1046516338 8:115266834-115266856 GAGAGTTGCCATTAGCAGGTAGG + Intergenic
1046902021 8:119534025-119534047 AAGAGTTGGCCTTAGGAGGAGGG + Intergenic
1047192640 8:122692175-122692197 AAGTGTTTGAATTAGCAGGTGGG + Intergenic
1047463830 8:125093288-125093310 AGGTGATGGTATTAGGAGGTGGG - Intronic
1047962581 8:130021616-130021638 ATGTGATGGTATTAGGAGGTGGG - Intergenic
1048049159 8:130801008-130801030 AGGTGATGGTATTAGGAGGTGGG - Intronic
1048377520 8:133835518-133835540 AGGTGCTTACATTAGGAGGTCGG + Intergenic
1048489681 8:134881037-134881059 ATGTGATGTTATTAGGAGGTAGG + Intergenic
1048547605 8:135402412-135402434 ACGTGATGGCATTAGGAGGTGGG - Intergenic
1048713340 8:137238820-137238842 AAGTGATGGTATTAGGACGTGGG - Intergenic
1049073154 8:140372602-140372624 AGGTGATGGAATTAGGAGGTGGG + Intronic
1049488396 8:142878367-142878389 GAATGTTGTCATTAGGACGGGGG - Intronic
1050103954 9:2146284-2146306 AGGTGATGGTATTAGGAGGTGGG - Intronic
1050153330 9:2639372-2639394 ACATGATGTTATTAGGAGGTAGG - Intronic
1050166331 9:2768691-2768713 AAGTGATGGTATTTGGAGGTGGG - Intronic
1050219373 9:3369408-3369430 AAGTGATGGTATTAGAAGGTGGG - Intronic
1050529546 9:6576421-6576443 AGGTGACGGCATTAGGAGGTGGG - Intronic
1050665547 9:7932281-7932303 AGGTGATGATATTAGGAGGTGGG - Intergenic
1050759697 9:9052264-9052286 AGATGTTGATATTAGGAGGTGGG - Intronic
1050778570 9:9300533-9300555 ATGTGTTGGTAGTAGGAGGTTGG + Intronic
1051224030 9:14879986-14880008 ATGTGATGGGATTAGGAGGTAGG + Intronic
1051316217 9:15835799-15835821 AAGTGTTGTCATTACTATTTTGG + Intronic
1051662663 9:19440386-19440408 AGGTGATGATATTAGGAGGTGGG + Intronic
1051700134 9:19813705-19813727 AAGTGATGATATTTGGAGGTGGG + Intergenic
1051722102 9:20047776-20047798 AGGTGATGGTATTAGGAGGTGGG - Intergenic
1051740521 9:20247410-20247432 AGGTGATGGCATTAGGAGGTAGG + Intergenic
1051811725 9:21056957-21056979 AAGTGATAGTATTAGGAGGTGGG + Intergenic
1051829592 9:21260775-21260797 AAGTGATGGTATTAGAAGGTAGG + Intergenic
1052050863 9:23848839-23848861 AAGTTTTCTCATTTGAAGGTTGG - Intergenic
1052252253 9:26412153-26412175 AGGTGATGGTATTAGGAGGTGGG + Intergenic
1052622392 9:30930311-30930333 ATGTGATGGTATTAGGAGGTGGG - Intergenic
1053259337 9:36648224-36648246 AAGGGATGTCATTAGAAGTTTGG + Intronic
1053639750 9:40059992-40060014 ATGTGTTAGCATTTGGAGGTGGG + Intergenic
1053766383 9:41405489-41405511 ATGTGTTAGCATTTGGAGGTGGG - Intergenic
1054320498 9:63656296-63656318 ATGTGTTAGCATTTGGAGGTGGG + Intergenic
1054544999 9:66316648-66316670 ATGTGTTAGCATTTGGAGGTGGG - Intergenic
1054704550 9:68449197-68449219 ACGTGATATTATTAGGAGGTAGG - Intronic
1054999643 9:71434249-71434271 AGGTGATGATATTAGGAGGTGGG + Intronic
1055722633 9:79192925-79192947 AGGTGATGGCATTAGGAAGTAGG - Intergenic
1055786051 9:79869920-79869942 ATGTGCTGTTATTAGGAGGCTGG + Intergenic
1055812482 9:80165430-80165452 AGGAGTTGCCATTAGGAGATTGG + Intergenic
1055828270 9:80352779-80352801 ATGTGATGTTATTAGGAGGCTGG + Intergenic
1055828378 9:80353734-80353756 ATGTGATGTTATTAGGAGGTTGG - Intergenic
1057415484 9:94858664-94858686 ATGTGATGGGATTAGGAGGTGGG + Intronic
1057855055 9:98595322-98595344 AACTGATGGTATTAGGAGGTAGG - Intronic
1058141009 9:101356903-101356925 AGGTGATGACATTAAGAGGTGGG - Intergenic
1058295758 9:103304217-103304239 ACGTGATGGTATTAGGAGGTGGG - Intergenic
1058600154 9:106660287-106660309 ATGTGATGGCATTTGGAGGTGGG - Intergenic
1058850312 9:109005428-109005450 ATGTGATGGTATTAGGAGGTGGG + Intronic
1058890715 9:109358408-109358430 ATGTGATGGCATTAGGAAGTGGG + Intergenic
1059544333 9:115161078-115161100 ATGTGATGGTATTAGGAGGTGGG + Intronic
1059621957 9:116015653-116015675 AAGAGTTGTCACCAGGAGCTGGG - Intergenic
1060423601 9:123486789-123486811 ATGTGTGGTCAATAGGAGGGTGG - Intronic
1060500449 9:124149685-124149707 ATGTGATGGCATTAAGAGGTGGG - Intergenic
1060730853 9:126036100-126036122 AAGTGCTGTGATGAGGAGGCAGG - Intergenic
1060908162 9:127326713-127326735 ATGTGGTGGTATTAGGAGGTGGG + Intronic
1061223728 9:129267786-129267808 AGGTGGTGGCATGAGGAGGTGGG + Intergenic
1202787568 9_KI270719v1_random:43306-43328 ATGTGTTAGCATTTGGAGGTGGG + Intergenic
1185869653 X:3653145-3653167 AAGTGATAGGATTAGGAGGTGGG + Intronic
1186026999 X:5324181-5324203 AGGTGATGGCATTAGGAGATGGG + Intergenic
1186037882 X:5444317-5444339 AGATGTTGGTATTAGGAGGTGGG - Intergenic
1186094610 X:6086066-6086088 AAGTGTTGCTATTTGGATGTAGG + Intronic
1186450935 X:9673107-9673129 AGGGGATGGCATTAGGAGGTGGG - Intronic
1186468830 X:9805434-9805456 AGGTGATGGTATTAGGAGGTGGG + Intronic
1186536489 X:10355541-10355563 AAGACTGGTCATTAGGAGTTGGG + Intergenic
1186725723 X:12356463-12356485 AAGTGATGGTATTAGGAGGTGGG + Intronic
1186987033 X:15028368-15028390 AGGTGATGGTATTAGGAGGTAGG + Intergenic
1187394623 X:18908501-18908523 CAATGATGACATTAGGAGGTGGG + Intronic
1187402571 X:18974793-18974815 ATGTGATGGCATTAGGCGGTGGG - Intronic
1187729220 X:22235637-22235659 ATGTGATGGCATTAGGAGTTGGG - Intronic
1187823749 X:23314602-23314624 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1188622224 X:32240285-32240307 AGGTGATGACATTAGGAAGTGGG + Intronic
1188952072 X:36388693-36388715 AAGTGCTGTCATTGAGAGCTTGG + Intergenic
1188992246 X:36836031-36836053 ATGTGATGTTATTAGAAGGTGGG + Intergenic
1189170203 X:38901707-38901729 AGGTGATGGCATTAGGAAGTGGG + Intergenic
1189366880 X:40395643-40395665 ATGTGATGGTATTAGGAGGTGGG - Intergenic
1189548830 X:42072193-42072215 AAGTGATGGTATTAGGAAGTAGG + Intergenic
1189671330 X:43413393-43413415 ATGTGATGGGATTAGGAGGTGGG + Intergenic
1189732579 X:44036937-44036959 AGATGATGTTATTAGGAGGTGGG + Intergenic
1189797437 X:44658976-44658998 ACGTGATGGTATTAGGAGGTGGG - Intergenic
1190163979 X:48056277-48056299 AAGTGATGATATTAGAAGGTGGG - Intronic
1190372034 X:49751978-49752000 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1190950050 X:55134626-55134648 ATGTGATGGTATTAGGAGGTGGG - Intronic
1191971995 X:66827126-66827148 AGGTGATGGCATTAGGAGGTGGG - Intergenic
1192374159 X:70542138-70542160 AGGTGATGATATTAGGAGGTGGG + Intronic
1192392097 X:70740471-70740493 AAGTGATGATATTAAGAGGTGGG - Intronic
1193212660 X:78825964-78825986 AAGAGCTGTCATTGGGATGTGGG + Intergenic
1193583824 X:83295884-83295906 TAGTGTGGTCATTTGGAGGAAGG - Intergenic
1193614255 X:83668404-83668426 TAGTGTGGTCATTTGGAGGTGGG - Intergenic
1194796911 X:98223229-98223251 AGGTGATGGTATTAGGAGGTGGG + Intergenic
1194957576 X:100198640-100198662 AGGTGATGACATTAGGAGGTTGG + Intergenic
1195163944 X:102198799-102198821 AGGTGATGTTATTAGGAGCTGGG + Intergenic
1195169601 X:102253107-102253129 AGGTGATGCCATTAGGAGGTGGG - Intergenic
1195189256 X:102433992-102434014 AGGTGATGCCATTAGGAGGTGGG + Intronic
1195194917 X:102488296-102488318 AGGTGATGTTATTAGGAGCTGGG - Intergenic
1195407792 X:104535666-104535688 ATGTGTTGCTATTAAGAGGTGGG - Intergenic
1195651991 X:107294628-107294650 AGGTGATGGTATTAGGAGGTGGG - Intergenic
1195779833 X:108449838-108449860 AGGTGATGGCATTAGGAGGTGGG - Intronic
1196081974 X:111642175-111642197 AAGTGATGGTATTAGGAGGTGGG - Intergenic
1196184847 X:112735100-112735122 GTGTGATGTCATTTGGAGGTGGG + Intergenic
1196407580 X:115380807-115380829 AGGTGATGGTATTAGGAGGTGGG + Intergenic
1196822978 X:119718155-119718177 AAGTGATAGTATTAGGAGGTAGG - Intergenic
1196964332 X:121039266-121039288 ATGTGATGGTATTAGGAGGTGGG - Intergenic
1197405749 X:126046955-126046977 ATGTGATGATATTAGGAGGTGGG + Intergenic
1197435841 X:126426880-126426902 AGGTGATGGTATTAGGAGGTAGG - Intergenic
1197501567 X:127248720-127248742 AAGTGTTTTGAGTGGGAGGTGGG - Intergenic
1197606174 X:128588076-128588098 ATGTGATGCTATTAGGAGGTGGG + Intergenic
1197787124 X:130209917-130209939 AAGTGATGGCATTAAGAGGTGGG + Intronic
1197824578 X:130575211-130575233 ATGTGATGGCATTAGGAGGTGGG - Intergenic
1197925430 X:131642363-131642385 ATGTGTTGATATTAGGAGGTGGG - Intergenic
1198170596 X:134101670-134101692 AGGTGATGGTATTAGGAGGTGGG + Intergenic
1198174587 X:134142900-134142922 AGGTGATGGTATTAGGAGGTGGG - Intergenic
1198221857 X:134609860-134609882 ATGTGATGGCATTTGGAGGTGGG - Intronic
1198463246 X:136882825-136882847 AGGTGATGGCATTAGGAGGCGGG + Intergenic
1198463957 X:136888229-136888251 AGGTGATGGTATTAGGAGGTGGG + Intergenic
1198601124 X:138285295-138285317 ATGTGATGGTATTAGGAGGTGGG - Intergenic
1198881961 X:141291492-141291514 AGGTGATGGCATTAAGAGGTGGG - Intergenic
1199020588 X:142872589-142872611 ATGTGATGTTATTAGGAGGTGGG + Intergenic
1199045813 X:143170288-143170310 ATGTGATGGTATTAGGAGGTGGG - Intergenic
1199130219 X:144176219-144176241 ATGTGATGGTATTAGGAGGTAGG - Intergenic
1199191135 X:144972513-144972535 ATGTGGTGGTATTAGGAGGTGGG + Intergenic
1199211400 X:145215697-145215719 AGGTGATGGTATTAGGAGGTGGG + Intergenic
1199245681 X:145600745-145600767 TAGTGTGGTCATTTGGAGATAGG - Intergenic
1199748354 X:150790914-150790936 ATGTGATGATATTAGGAGGTGGG + Intronic
1199762458 X:150915606-150915628 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1200180881 X:154150085-154150107 AGGTGATGGTATTAGGAGGTGGG - Intronic
1200186524 X:154187199-154187221 AGGTGATGGTATTAGGAGGTGGG - Intergenic
1200192176 X:154224337-154224359 AGGTGATGGTATTAGGAGGTGGG - Intronic
1200197931 X:154262141-154262163 AGGTGATGGTATTAGGAGGTGGG - Intronic
1200326019 X:155240127-155240149 AGGTGATGGTATTAGGAGGTGGG - Intergenic
1201148187 Y:11078019-11078041 ATGTGATGGCATTTGGAGGTAGG + Intergenic
1201148967 Y:11084661-11084683 ATGTGATGACATTTGGAGGTAGG + Intergenic
1201227800 Y:11835000-11835022 AAGTGATGGCACTAGGAGGTGGG + Intergenic
1201446668 Y:14064495-14064517 AGGTGATGGCATTACGAGGTGGG + Intergenic