ID: 1174650223

View in Genome Browser
Species Human (GRCh38)
Location 20:52118631-52118653
Sequence TTGGGTTGCCACTGGGGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 331}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174650216_1174650223 10 Left 1174650216 20:52118598-52118620 CCTGAAGCTATTCATTTGTTTAA 0: 1
1: 0
2: 1
3: 33
4: 357
Right 1174650223 20:52118631-52118653 TTGGGTTGCCACTGGGGGCAAGG 0: 1
1: 0
2: 0
3: 19
4: 331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174650223 Original CRISPR TTGGGTTGCCACTGGGGGCA AGG Intronic
900126348 1:1070546-1070568 CTGGGTTCCCACAGGGGTCATGG + Intergenic
900694667 1:4002336-4002358 AAGGGGTGCCCCTGGGGGCAGGG + Intergenic
901045854 1:6395318-6395340 GTGGGTTGCCACTGCTGGCTCGG + Intergenic
901652645 1:10752033-10752055 CTGGGCTGTCACTGCGGGCAGGG - Intronic
902648145 1:17818436-17818458 GTGGGAGGCCACTGGGGGCTTGG - Intronic
903645844 1:24896105-24896127 TTCATGTGCCACTGGGGGCAAGG - Intergenic
904419270 1:30381150-30381172 TTGGGTTGAGACTGGGGGCGGGG - Intergenic
905793738 1:40803723-40803745 TGGGGTTCCCACTGGGAGCATGG + Intronic
906232135 1:44172655-44172677 ATGGGTTGACACTGGCAGCAGGG + Intergenic
906396471 1:45470740-45470762 TTGGGTAGCCACTAGGTGCAAGG + Intronic
907428373 1:54395782-54395804 TTGGGTTGTGACTGGTGGCTTGG - Intronic
907468029 1:54652446-54652468 TGGGGTTGCCCCAGGGGCCAAGG + Intronic
907476683 1:54710514-54710536 TTGGATGGCCACTGGGGAAAGGG + Intronic
907980204 1:59473063-59473085 GTGGGTTGCCACTGCTGGCTCGG - Intronic
908888724 1:68818537-68818559 CTGGGTTGCCACTGCAGGCTCGG - Intergenic
909747239 1:79112931-79112953 ATGGGTTGCCACTGCTGGCTGGG - Intergenic
910876507 1:91883933-91883955 TGGGGTTGGCACAGGAGGCAGGG - Intronic
912385680 1:109270185-109270207 AGGGGTTGCCAGTGGGGGCTGGG - Intronic
913469125 1:119172281-119172303 GTGGGTTGCCACTGCTGGCTGGG - Intergenic
914352142 1:146849695-146849717 CTGGGTTACCACTTGGTGCATGG - Intergenic
915131334 1:153697551-153697573 TAGGGTGGCCACTGGGAGCTTGG + Intergenic
915242210 1:154531711-154531733 GTGGGTTGCCACTGCTGGCTCGG + Intronic
916827232 1:168453939-168453961 TTGGGTTGGCAGTGGGAGCTTGG - Intergenic
917173297 1:172201726-172201748 TTCAGTTGCCCCTGGGGGCCTGG + Intronic
917932854 1:179836480-179836502 ACGGGTTGCCACTGGTGGCTCGG + Intergenic
919049646 1:192498540-192498562 GTGGGTTGCCACTGCTGGCCAGG + Intergenic
919092040 1:192987728-192987750 GTGGGTTGCCACTGCTGGCTCGG - Intergenic
919205979 1:194422366-194422388 GTGGGTTGCCACTGCTGGCTGGG - Intergenic
920756815 1:208740492-208740514 GTGGGTTGCCACTGCTGGCTCGG - Intergenic
920942824 1:210500104-210500126 TTGGGTTACCAACAGGGGCAAGG + Intronic
921396247 1:214672689-214672711 TCGGGTTGCCACTGCTGGCTTGG + Intergenic
921854363 1:219965367-219965389 GTGTGTTGCCACTGGTGACAGGG + Intergenic
923157105 1:231289034-231289056 TTCGGTTGCCACTGCTGGCTTGG + Intergenic
923929928 1:238684017-238684039 GTGGGTTGCCACTGCTGGCTTGG + Intergenic
924219105 1:241855124-241855146 GTGGGTTGCCACTGCTGGCTGGG + Intronic
1063859404 10:10291365-10291387 GTGGGTTGCCACTGCTGGCTGGG + Intergenic
1067375189 10:45721207-45721229 TTGAGTGCCCACTGTGGGCAGGG - Intergenic
1067378540 10:45751308-45751330 TTGAGTGCCCACTGTGGGCAGGG + Intronic
1067781303 10:49209335-49209357 CTGTGCTGTCACTGGGGGCAAGG - Intergenic
1067886235 10:50091988-50092010 TTGAGTGCCCACTGTGGGCAGGG + Intronic
1071900877 10:90119372-90119394 GTGGGTTGCCACTGCTGGCTCGG + Intergenic
1072048741 10:91682555-91682577 GTTGTATGCCACTGGGGGCAGGG + Intergenic
1072278618 10:93846003-93846025 GTGGGTTGCCACTGCTGGCTCGG - Intergenic
1073769348 10:106718630-106718652 GTGGGTTGCCACTGCTGGCTGGG + Intronic
1074613423 10:115042332-115042354 GTGGGTTGCCACTGCTGGCTCGG - Intergenic
1074697342 10:116061694-116061716 TTGGGGTGCCACTGAAGACAGGG - Intronic
1075504868 10:123012838-123012860 TTGGATTGCCACTGCTGGCTCGG + Intronic
1075714314 10:124547461-124547483 GTGGGTGGACACTGGGGGCAGGG - Intronic
1076261456 10:129070288-129070310 GTGGGTTGCCACTGCTGGCTCGG + Intergenic
1076724410 10:132406839-132406861 TTGGGGGGTCACAGGGGGCAGGG - Intronic
1076773721 10:132681262-132681284 GTGGGTTGCCACTGCTGGCTCGG - Intronic
1076789172 10:132767744-132767766 CTGGAATGCCACTGGGCGCATGG - Intronic
1076796402 10:132800490-132800512 GTGGGTTGCCACTGCTGGCTCGG + Intergenic
1077151458 11:1074860-1074882 GTGGGTTGCGCCCGGGGGCAGGG - Intergenic
1077513022 11:2981482-2981504 TTGGGTTGCTGCTGTGGTCATGG - Intronic
1078150129 11:8751393-8751415 GTGGGTTGCCACTGCTGGCTTGG - Intronic
1078253883 11:9640758-9640780 TTGTGTGGCCACTGCAGGCAGGG + Intergenic
1078402367 11:11039486-11039508 TTGGGTAGCCACTATGGGGAAGG - Intergenic
1078439049 11:11348992-11349014 ATGGGTTACCTCTGGGGGTAAGG - Intronic
1078739434 11:14052707-14052729 TCGGGATGCCAGTGGGAGCATGG + Intronic
1079756678 11:24273765-24273787 GTGGGTTGCCACTGCTGGCTCGG + Intergenic
1082906449 11:58312416-58312438 GTGGGTTGCCACTGCTGGCTGGG + Intergenic
1082924746 11:58532787-58532809 GTGGGTTGCCACTGCTGGCTCGG - Intronic
1084440924 11:69172740-69172762 TGGGGCTGCCACAGGGAGCAGGG + Intergenic
1084813515 11:71631126-71631148 GTGGGTTGCCACTGCTGGCTCGG + Intergenic
1084831845 11:71775498-71775520 GTGGGTTGCCACTGCTGGCTGGG - Intergenic
1087074701 11:94118532-94118554 GTGGGTTGCCACTGCTGGCTCGG - Intergenic
1089693599 11:120201826-120201848 TTGTGTGGTGACTGGGGGCAGGG - Intergenic
1090157764 11:124459642-124459664 TCGGGTTGCCACTGGGGCTCAGG - Intergenic
1090204131 11:124875559-124875581 GTGGGGGGCCACTGGGGGCTGGG - Exonic
1090586051 11:128214549-128214571 CTGGGTTGCCACTGCAGGCTCGG + Intergenic
1091311767 11:134579918-134579940 TTGAGCTGCCACTGTGGGGAAGG - Intergenic
1092990256 12:13890480-13890502 TAGTGCTGCCACTGGGCGCATGG - Intronic
1093381669 12:18500750-18500772 GTGGGTTGCCACTGCTGGCTTGG - Intronic
1093580905 12:20783324-20783346 ATGGGTTGCCACTGCTGGCTTGG + Intergenic
1093893421 12:24550528-24550550 TAGGATTGCTTCTGGGGGCAGGG - Intergenic
1094598008 12:31883063-31883085 GTGGGTTGCCACTGCTGGCTGGG - Intergenic
1094718063 12:33033473-33033495 TTGGGTTGCCACTGCTGGCTTGG + Intergenic
1095597217 12:43972489-43972511 GTGGGTTGCCGCTGGTGGCTGGG + Intronic
1096693427 12:53334805-53334827 TTGGGGTACCACTGGGGTCAGGG - Intronic
1100210528 12:92393996-92394018 GTGGGTTGCCACTGCTGGCTGGG - Intergenic
1100643707 12:96507284-96507306 TTGGGTTTTCACTGGGGAAAGGG + Intronic
1101021768 12:100560276-100560298 GTGGGTTGCCAATGCGGGCTCGG - Intronic
1102387118 12:112519474-112519496 GTGGGTTGCCACTGCTGGCTCGG + Intergenic
1103291649 12:119851045-119851067 TTGGATTGGAACTGGGGGCACGG + Intronic
1103526826 12:121574794-121574816 TTGAGTTGCCTCTTGGGGTAGGG - Intronic
1103624549 12:122207958-122207980 TTGGGATGCCAGTTGTGGCAGGG - Exonic
1104950048 12:132435881-132435903 TTGGGCTGGCGCTGGGGGCTCGG - Intergenic
1105722326 13:23128668-23128690 TTGGGTTGCCAATGCTGGCTCGG - Intergenic
1106512652 13:30424753-30424775 TTGGGTGGTCACTGTGGGCCAGG - Intergenic
1106600426 13:31182594-31182616 GTGGGTTGCCACTGCTGGCTCGG + Intergenic
1107446210 13:40472296-40472318 TTGGGGTGGCAGTGGGGGGATGG - Intergenic
1107895562 13:44959172-44959194 TTGGGTGGGCACATGGGGCAGGG - Intronic
1108867252 13:54938650-54938672 GTGGGTTGCCACTGCTGGCTGGG - Intergenic
1109152007 13:58858556-58858578 GTGGGTTGCCACTGCTGGCTGGG + Intergenic
1109711431 13:66165393-66165415 TTGGGTTTTCATAGGGGGCACGG + Intergenic
1110141696 13:72138591-72138613 TTTGGTTACCATTGGGAGCATGG + Intergenic
1111267379 13:85834942-85834964 TTAGGCAGCCACTGGGGGCTTGG + Intergenic
1111957748 13:94776520-94776542 TAGTGTTGGCACTGGGGGCTCGG - Intergenic
1113924213 13:113931170-113931192 TGGGGTTACCTCTGGGGGCCGGG - Intergenic
1114593680 14:23892694-23892716 GTGGGTTGCCACTGCTGGCTGGG - Intergenic
1118318087 14:64737725-64737747 TCAGGTTGCCACTGGGGTCCAGG - Intronic
1121077681 14:91083095-91083117 TAGGGTTGCAAGTTGGGGCAGGG - Intronic
1121352406 14:93184438-93184460 TGGCGTCGCCGCTGGGGGCAGGG - Intronic
1121915893 14:97836712-97836734 TTGGGTTGCAGCTGAGGGTAGGG + Intergenic
1122217338 14:100212997-100213019 TTGGGGTGGCAGAGGGGGCAGGG + Intergenic
1122551199 14:102550937-102550959 TGGGGCTGCCACTGTGGGCCTGG + Intergenic
1122937349 14:104966327-104966349 TTGGGCTGACACCGTGGGCAAGG - Intronic
1123948986 15:25252575-25252597 GTGGGTTGCCACTGCTGGCTGGG + Intergenic
1124036503 15:26057820-26057842 GTGGGTTGCCACTGCTGGCTAGG - Intergenic
1125967290 15:43884623-43884645 TTTGGTAGCCACTGGAGCCAGGG + Intronic
1127765934 15:62186078-62186100 GTGGGTTGCCACTGCTGGCTAGG + Intergenic
1128065378 15:64761308-64761330 TTGGGTTGCTACTGAGGGCTGGG - Intronic
1132615510 16:839532-839554 GTGGGTCCACACTGGGGGCAGGG - Intergenic
1133008086 16:2895753-2895775 TTGTGTTGTCACAGGGAGCATGG - Intronic
1133352041 16:5108108-5108130 GTGGGTTGCCACTGCTGGCTGGG + Intergenic
1133357032 16:5144079-5144101 TTGGTTTGGAAGTGGGGGCAGGG + Intergenic
1133879724 16:9769510-9769532 TTGGGTGGGTATTGGGGGCAGGG - Intronic
1135613236 16:23886949-23886971 TTGGGGGGTCACTGGGGCCATGG + Intronic
1139981888 16:70865837-70865859 CTGGGTTACCACTTGGTGCATGG + Intronic
1140790195 16:78384155-78384177 TGGGGTTTCCACTGGGGGCTTGG + Intronic
1141160880 16:81628348-81628370 TTGGGGTGCAACTGGGGGCTCGG - Intronic
1143109747 17:4546364-4546386 TTGGGAGGCCAAGGGGGGCAAGG - Intronic
1143204722 17:5133727-5133749 TTGGCTTGCTACTGAGGCCAGGG - Intronic
1143381559 17:6499371-6499393 TTGGGTTGCAAGTGTGGGGAGGG - Intronic
1143479757 17:7221495-7221517 TGGGGTTGTCACTGGCTGCAGGG - Intronic
1146653653 17:34622595-34622617 CTGGGTGGCCACTGAGGGGAGGG - Intronic
1146904719 17:36610706-36610728 TTGGCTTGTCATTGGGGTCAAGG + Intergenic
1147114729 17:38290432-38290454 TGGGGTGGACTCTGGGGGCAGGG + Intergenic
1147161229 17:38570589-38570611 ATGTGTTGACACTGGTGGCAGGG - Intronic
1147910754 17:43854517-43854539 CTGGGTTGGCAATGGGGGCGGGG + Intronic
1147924686 17:43939072-43939094 ATGGGTTGCCAGGGGAGGCAGGG - Intergenic
1148414885 17:47498773-47498795 TGGGGTGGACTCTGGGGGCAGGG - Intergenic
1150134513 17:62688640-62688662 GTTTGTTGCCACTGGGAGCAGGG - Exonic
1150792359 17:68208593-68208615 ATGGGTTGCCACTGCTGGCTGGG - Intergenic
1152257995 17:79251502-79251524 TTGGGTGGGCACTGGAGACAAGG - Intronic
1152355969 17:79807479-79807501 CTGGATTGTCACAGGGGGCAGGG + Intergenic
1152577537 17:81149430-81149452 TTGGGTTTCCTCAGGGGGCTGGG - Intronic
1153352084 18:4092409-4092431 TTTGGTTGACACTGGGAGGAGGG - Intronic
1153643907 18:7178089-7178111 GTGGGTTGCCACTGTTGGCTCGG + Intergenic
1154255154 18:12776128-12776150 GTGGGTTGCCACTGCGAGCTTGG + Intergenic
1154321215 18:13354784-13354806 TTTGGTCGGCACTGAGGGCAAGG + Intronic
1159903146 18:74066702-74066724 GGGGGTTGCCCCTGGGGACAGGG - Intergenic
1161124678 19:2549132-2549154 TTGGGTTGGCACAGGAGTCAGGG - Intronic
1161262924 19:3347472-3347494 CTGGGTTGACACTGGGTGCTGGG - Intergenic
1161270715 19:3387932-3387954 TTGGGCTGCCAGAGGGGGCGGGG - Intronic
1161331370 19:3689291-3689313 TTGGGTTTCCCCTGGAGCCAGGG + Intronic
1162107145 19:8376700-8376722 GTGGGTTGCCACTGCTGGCTCGG - Intronic
1163513991 19:17751926-17751948 TGGGGTTGCCTCTGAGGGCATGG + Intronic
1163546482 19:17943881-17943903 ATGGGGTGTCACTCGGGGCAGGG - Exonic
1165800420 19:38546236-38546258 TGGGGTTGGCACTTGGGGGACGG - Intronic
1165846750 19:38822827-38822849 GTGGGTTGCCACTGCTGGCTCGG - Intronic
1166626655 19:44363460-44363482 AGTGGTTGCCACTGGGGGAAGGG - Intronic
1168101847 19:54145493-54145515 TTGGGTCTCCACAGGGGTCAGGG + Intronic
1168145242 19:54416588-54416610 TTGGGTTGCTCCTGGGAGAAGGG + Intronic
926512630 2:13801613-13801635 GTGGGTTGCCACTGCTGGCTGGG + Intergenic
928700188 2:33891091-33891113 GTGGGTTGCCACTGCCGGCTGGG - Intergenic
929547055 2:42862703-42862725 TTGAGGGGCCACTGAGGGCAGGG + Intergenic
930038145 2:47100551-47100573 GTGGGTTGCCACTGCTGGCTCGG - Intronic
930039363 2:47108256-47108278 GTGGGTTGCCACTGCTGGCTCGG - Intronic
933712015 2:85333785-85333807 GTGGGTTGCCACTGCTGGCTGGG + Intergenic
935578151 2:104732162-104732184 TTGGGTTTCCACTGGGGAGTGGG - Intergenic
935878243 2:107535647-107535669 GTGGGTTGCCACTGCTGGCTCGG + Intergenic
938546828 2:132340926-132340948 AGTGGTTGCCACTGGGGGAAGGG + Intergenic
939777215 2:146403117-146403139 TTGGGTTGCCAATGCTGGCTAGG + Intergenic
940584394 2:155626675-155626697 TTGGGCTTCCTGTGGGGGCACGG + Intergenic
941089812 2:161161075-161161097 CTGGGTTCCCACTGTGGGCGGGG - Intronic
941240216 2:163027054-163027076 GTGGGTTGCCACTGCTGGCTAGG - Intergenic
942765022 2:179444804-179444826 TTGGGCAGCCATTGTGGGCAAGG - Intronic
943402923 2:187438679-187438701 TTGTGTGGCCACTTGGGGAAAGG + Intronic
944857791 2:203785046-203785068 GTGGGTTGCCACTGCTGGCTTGG + Intergenic
945401510 2:209388174-209388196 GTGGGTTGCCACTGCAGGCTAGG - Intergenic
948618463 2:239216991-239217013 TTGGGGTTACACTGGGGGAAGGG - Intronic
1171262006 20:23742325-23742347 GTGGGTTGCCACTGCTGGCTAGG - Intergenic
1171524658 20:25799426-25799448 TGGGGTTGCGGCTGGGTGCAGGG - Intronic
1171552169 20:26056457-26056479 TGGGGTTGCGGCTGGGTGCAGGG + Intergenic
1171875694 20:30573652-30573674 AGTGGTTGCCACTGGGGGAAGGG + Intergenic
1172661432 20:36571953-36571975 TGGGGAAGCCACTGGGGGCCTGG - Intergenic
1173045340 20:39504343-39504365 TGGAGTTGGCCCTGGGGGCATGG - Intergenic
1173221915 20:41138009-41138031 TCGGGTGGTCACTGGGGGCGGGG + Intronic
1173671153 20:44799727-44799749 TTGGGGTGCCTCAGGGGACAGGG + Intronic
1173855294 20:46246591-46246613 CAGGGTTGCCAATGGGGGCAGGG + Intronic
1173980678 20:47221549-47221571 CTTGGGTGCCACTGGGTGCAGGG - Intronic
1174650223 20:52118631-52118653 TTGGGTTGCCACTGGGGGCAAGG + Intronic
1176172349 20:63701673-63701695 TTGGGAAGCTGCTGGGGGCAGGG + Intronic
1176218421 20:63958911-63958933 CTGAGTGGCCACTGGGGGAAAGG - Exonic
1176240638 20:64074368-64074390 TTGGCGTGGCACTGTGGGCACGG + Exonic
1176332181 21:5559243-5559265 GTGGGTTGCCACTGCTGGCTGGG + Intergenic
1176395576 21:6261708-6261730 GTGGGTTGCCACTGCTGGCTGGG - Intergenic
1176441581 21:6727396-6727418 GTGGGTTGCCACTGCTGGCTGGG + Intergenic
1176465843 21:7054465-7054487 GTGGGTTGCCACTGCTGGCTGGG + Intronic
1176489404 21:7436243-7436265 GTGGGTTGCCACTGCTGGCTGGG + Intergenic
1177399546 21:20584843-20584865 GTGGGTTGCCACTGCTGGCTGGG - Intergenic
1178365526 21:31986292-31986314 ATGGGTTGGCTCTGGGGGTAAGG - Intronic
1179139490 21:38712174-38712196 TTGGATTGCCTCTGGCTGCAAGG + Intergenic
1179148547 21:38790273-38790295 TTGGATATCCACTGAGGGCAAGG - Intergenic
1179450887 21:41467567-41467589 ATGGGTGGACACTGGGGGGATGG + Intronic
1179532341 21:42028539-42028561 TTGGGTTGCCTCTGGGTGACAGG + Intergenic
1179571748 21:42282629-42282651 TTGTGTTGACCCTGGGGGTATGG + Intronic
1180050156 21:45327404-45327426 TTCAGGTGACACTGGGGGCACGG + Intergenic
1180630947 22:17229565-17229587 TTGGGTTGCAACTGTGGAGATGG - Intergenic
1180786686 22:18551596-18551618 TTGGTTGACCCCTGGGGGCAGGG - Intergenic
1180940770 22:19658485-19658507 TTTGGTTTCCACTTGGGGCCTGG - Intergenic
1180950174 22:19717304-19717326 TTGGGATTCTACTGGGGTCATGG + Intronic
1181131979 22:20737409-20737431 TTGGTTGACCCCTGGGGGCAGGG - Intronic
1181243600 22:21491117-21491139 TTGGTTGACCCCTGGGGGCAGGG - Intergenic
1181303477 22:21899704-21899726 TTGGGAGGCCAATGGGGGCGCGG - Intergenic
1181559861 22:23693792-23693814 TTGGGCTGCATCTGGGGCCAAGG + Exonic
1181956305 22:26589999-26590021 TCGGGTTGCAACCGGGGGCGCGG - Intronic
1183063179 22:35347684-35347706 TTGGCTGGCCACTGAGGGTAGGG + Exonic
1184332197 22:43834089-43834111 TAGGGTTGCTAGTGGGGACAGGG + Intronic
949901025 3:8814878-8814900 TTAGTCTACCACTGGGGGCAAGG - Intronic
950001308 3:9658581-9658603 GTGGGTAGCCACTGGGCCCATGG - Intronic
950951370 3:17003658-17003680 TTTGGCTGCCACAGGGAGCAGGG - Intronic
951301827 3:21007961-21007983 GTGGGTTGCCACTGCTGGCTGGG + Intergenic
953307475 3:41843751-41843773 GTGGGTTGCCACTGCTGGCTCGG + Intronic
953493989 3:43371162-43371184 TTGGTTTGGGACGGGGGGCAGGG - Intronic
953906421 3:46870532-46870554 TTGTATGGCCACTGGAGGCAAGG - Intronic
954073398 3:48159288-48159310 TTAGTCTACCACTGGGGGCAGGG + Intronic
955852378 3:63234414-63234436 TTGGGTTCCCACTGGAGGAAAGG + Intronic
956842432 3:73153113-73153135 GTGGGTTGCCACTGCTGGCTCGG + Intergenic
957056047 3:75443991-75444013 GTGGGTTGCCACTGCTGGCTGGG + Intergenic
957074209 3:75588585-75588607 GTGGGTTGCCACTGCTGGCTCGG - Intergenic
957983563 3:87543625-87543647 TTGGATTGCCTCTGGTGGGAGGG - Intergenic
958419993 3:93918352-93918374 GTGGGTTGCCACTGCTGGCTCGG - Intronic
958601040 3:96297833-96297855 GTGGGTTGCCACTGCTGGCTGGG - Intergenic
959285284 3:104400557-104400579 GTGGGTTGCCACTGCTGGCTCGG + Intergenic
959422887 3:106149610-106149632 GTGGGTTGCCACTGCTGGCTTGG - Intergenic
960295648 3:115940252-115940274 GTGGGTTGCCACTGCTGGCTGGG + Intronic
961298345 3:125904696-125904718 GTGGGTTGCCACTGCTGGCTTGG - Intergenic
962383640 3:134915912-134915934 ATGGGTTGCCACTGCTGGCTGGG + Intronic
963092626 3:141498905-141498927 TTGGTTTGCCACTTGAGGAAGGG + Intronic
964444133 3:156741344-156741366 GCGGGTTGCCACTGCGGGCTGGG - Intergenic
967852926 3:194095724-194095746 GTGGGCTGTCAGTGGGGGCAGGG - Intergenic
969273031 4:6115865-6115887 TTGGGCTGCCGGTGGGGGAAAGG + Intronic
969626963 4:8310601-8310623 TGGGGTTGGCTCTGGGGACATGG - Intergenic
969648039 4:8444944-8444966 TGGGGTTGCCACACTGGGCAGGG + Intronic
969815050 4:9680644-9680666 GTGGGTTGCCACTGCTGGCTGGG - Intergenic
970700453 4:18730677-18730699 GTGGGTTGCCGCTGCTGGCATGG + Intergenic
971924547 4:32990415-32990437 TTGGGTTGTGACTCGGTGCATGG + Intergenic
972358551 4:38305048-38305070 GTGGGTTGCCACTGCTGGCTTGG - Intergenic
973135385 4:46699840-46699862 GTGGGTTGCCACTGCTGGCTTGG - Intergenic
974207494 4:58724743-58724765 GTGGGTTGCCACTGCTGGCTGGG - Intergenic
975606661 4:76161819-76161841 TTGGGTGGGGAGTGGGGGCATGG + Intronic
981169444 4:141605030-141605052 GTGGGTTGCCACTGCTGGCTTGG + Intergenic
982587636 4:157262596-157262618 CTGGGTTGAAATTGGGGGCAAGG - Intronic
983835273 4:172377069-172377091 GTGGGTTGCCACTGCTGGCTCGG + Intronic
985548758 5:522950-522972 TGGGCTTTCCACTGGGGGCTTGG - Intronic
989964525 5:50452186-50452208 GTGGGTTGCCACTGCTGGCTCGG + Intergenic
990176350 5:53112585-53112607 GTGGGTTGCCACTGCTGGCTAGG - Intergenic
996681257 5:126229795-126229817 GTGGGTTGCCACTGCTGGCTCGG - Intergenic
997202114 5:132017067-132017089 TTAGGTGGCCACTGGGGAAAAGG - Intergenic
997226892 5:132215574-132215596 CTGGGTTGGGCCTGGGGGCAGGG - Intronic
997227740 5:132222065-132222087 TTGGGTTGCAGCTGGGAGCTTGG - Intronic
998857309 5:146405745-146405767 TTGGGTGGCCTCTGGGTGAAAGG + Intergenic
999305639 5:150517870-150517892 TTGGGTGGCCAACGTGGGCAGGG + Intronic
999527895 5:152428029-152428051 CTGTCTTGCCACTGGGTGCAGGG - Intronic
999605906 5:153315592-153315614 GTGGGTTGCCACTGCTGGCTAGG + Intergenic
999907468 5:156158093-156158115 TTAGGTTCCCACTGGTGGAAAGG + Intronic
1001689864 5:173625034-173625056 ATGGGGTGACACTGGAGGCAGGG + Intergenic
1002431714 5:179207951-179207973 TGGGGTTGCCACCAGGGGCTGGG - Intronic
1002602148 5:180360129-180360151 ATGGGTTGCCACTGTGTGCTGGG + Intergenic
1002899578 6:1399616-1399638 GTGGGTTGGCACTGGGGACCTGG - Intergenic
1004197269 6:13516269-13516291 GTGGGTTGACATTTGGGGCAGGG + Intergenic
1004343526 6:14828098-14828120 TTTGCTTGCAACTGGGGCCATGG - Intergenic
1004531029 6:16456045-16456067 ATGGGTTGCCACTGCTGGCTGGG - Intronic
1004585714 6:16997923-16997945 TGGGGTTGCCACTGGTGCCTGGG - Intergenic
1006033781 6:31196398-31196420 CTGGGTTGCCACTGCTGGCTCGG - Intergenic
1006222215 6:32500808-32500830 GTGGGTTGCCACTGCTGGCTCGG - Intergenic
1007738852 6:43998852-43998874 GCGGGTTGCCACTGCGGGCTGGG - Intergenic
1007843970 6:44738913-44738935 TGGGGTTGTCACTGGAGGAAGGG + Intergenic
1008230704 6:48982987-48983009 GTGGGTTGCCACTGCTGGCTGGG + Intergenic
1008254189 6:49276183-49276205 GTGGGTTGCCACTGCTGGCTGGG - Intergenic
1008513162 6:52296189-52296211 TCAGGTATCCACTGGGGGCATGG - Intergenic
1009406969 6:63325903-63325925 GTGGGTTGCCACTGCTGGCTTGG + Intergenic
1009746815 6:67826415-67826437 GTGGGTTGCCACTGCTGGCTGGG - Intergenic
1010074593 6:71785584-71785606 GTGGGTTGCCACTGCTGGCTTGG - Intergenic
1011225041 6:85096147-85096169 GTGGGTTGCCACTGCTGGCTGGG - Intergenic
1011618624 6:89221231-89221253 TTGGGTTGGCTCTGAGGGCTTGG - Intronic
1013113726 6:107084906-107084928 ATGGGTTGCCACTGCTGGCTTGG - Intronic
1014280958 6:119442002-119442024 GTGGGTTGCCACTGCTGGCTGGG - Intergenic
1016067239 6:139697464-139697486 GCGGGTTGCCACTGCGGGCTCGG + Intergenic
1016858788 6:148697587-148697609 TTGGGTTGCCACTGCTGGCTGGG + Intergenic
1017127462 6:151079391-151079413 TGGGAATGCCACTGGGGGCAGGG + Intronic
1017581082 6:155866295-155866317 GTGGGTTGCCACTGCTGGCTGGG + Intergenic
1017839356 6:158209240-158209262 GTGGGTTGCCACTGCTGGCTCGG + Intergenic
1019944118 7:4313361-4313383 TTGGGTTGCCACTGCTGGCTCGG + Intergenic
1019965606 7:4496351-4496373 TTGGGTTGCCACTGCTGGCTCGG + Intergenic
1022412181 7:30147940-30147962 TTGGGTACCCACTGGGTACATGG + Intronic
1024961682 7:54982914-54982936 TTGGGTTGAGGCAGGGGGCACGG - Intergenic
1025067411 7:55869302-55869324 CTGGGTTGCCACTGCTGGCTCGG - Intergenic
1026024257 7:66732310-66732332 TGGGGCTGCCTCTGGGGCCAGGG + Intronic
1026806526 7:73432810-73432832 TTGAGCTGCCACTGGGTACAAGG + Intergenic
1027667405 7:81057023-81057045 GTGGGTTGCCACTGCTGGCTTGG + Intergenic
1027668878 7:81072146-81072168 GTGGGTTGCCACTGCTGGCTTGG - Intergenic
1028070232 7:86441387-86441409 GTGGGTTGCCACTGCTGGCTCGG - Intergenic
1028641090 7:93043023-93043045 TTGAGTTGAAACTGGGGGTAAGG - Intergenic
1031056392 7:116997273-116997295 GTGGGTTGCCACTGCTGGCTCGG + Intronic
1031732394 7:125315129-125315151 GTGGGTTGCCACTGCTGGCTCGG - Intergenic
1032001818 7:128270865-128270887 TTGGGTAGCCACCGGGCGCTGGG - Intergenic
1033405687 7:141070697-141070719 TTGGGTTCCCACTGCAAGCAGGG + Intergenic
1035325536 7:158063497-158063519 GTGGGTTGCCACTGCTGGCTCGG - Intronic
1035999387 8:4583808-4583830 GTGGGTTGCCACTGCTGGCTGGG - Intronic
1036260595 8:7236481-7236503 GTGGGTTGCCACTGCTGGCTCGG - Intergenic
1036306018 8:7603041-7603063 GTGGGTTGCCACTGCTGGCTCGG + Intergenic
1036312632 8:7695037-7695059 GTGGGTTGCCACTGCTGGCTCGG - Intergenic
1036356864 8:8051026-8051048 GTGGGTTGCCACTGTTGGCTCGG + Intergenic
1036851192 8:12202965-12202987 ATGGGTTGCCACTGCTGGCTGGG + Intergenic
1036872556 8:12445239-12445261 ATGGGTTGCCACTGCTGGCTGGG + Intergenic
1038012986 8:23489484-23489506 GTGGGTTGCCACTGCTGGCTGGG - Intergenic
1039475244 8:37836197-37836219 TTAGGTAGCCTCTGGGAGCAGGG - Intronic
1041541933 8:58994764-58994786 TTGGGTTGCCTGTGTGGGAATGG - Intronic
1043613126 8:82091070-82091092 GTGGGTTGCCACTGCTGGCTGGG + Intergenic
1044880542 8:96718628-96718650 GTGGGTTGCCACTGCTGGCTCGG + Intronic
1045049095 8:98306611-98306633 TTTGGGTGCTCCTGGGGGCAGGG + Intergenic
1045112347 8:98947651-98947673 CTGTGTTGCCATTGGGAGCACGG + Intronic
1046158966 8:110333921-110333943 TTGGTTTGCCAATTGGGGCAGGG - Intergenic
1048210433 8:132450134-132450156 GTGGGTTGCCACTGCTGGCTGGG + Intronic
1049186314 8:141256045-141256067 TGGGTTTGTCACTGGAGGCAGGG - Intronic
1050560326 9:6828492-6828514 TTGGGCTGCCACTTGAGGTAAGG + Intronic
1052290108 9:26830530-26830552 ATGGGTTGCCACTGCTGGCTTGG - Intergenic
1052615812 9:30839686-30839708 TTGAGTTGCCACTGGAAGAAAGG + Intergenic
1055769658 9:79703704-79703726 TAGGAATGCCACTGGGGCCAGGG - Intronic
1055985396 9:82053888-82053910 GTGGGTTGCCACTGCTGGCTCGG + Intergenic
1056105802 9:83345175-83345197 CTGTGTGGGCACTGGGGGCATGG + Intronic
1056385916 9:86097534-86097556 TGGGGTGGCCATTGGGGGCGGGG - Intronic
1057227806 9:93301719-93301741 TGGGGCTGTCACTGGGGGCGAGG + Intronic
1057237363 9:93372672-93372694 TTGTGTGGCCACAGGGTGCATGG - Intergenic
1057568778 9:96187505-96187527 TTGGGGTGAGATTGGGGGCAGGG + Intergenic
1057716791 9:97501956-97501978 TCGGGTTGCCTCTGGGGCTAGGG + Intronic
1058923145 9:109637400-109637422 TTTGGATGTGACTGGGGGCAAGG + Intergenic
1062003519 9:134228387-134228409 TTGGGATGCCACTGGGTCCTGGG + Intergenic
1062006125 9:134239448-134239470 AGGGGCTCCCACTGGGGGCAGGG - Intergenic
1062365406 9:136205855-136205877 TTGCTGTGCCAGTGGGGGCAGGG - Intergenic
1203429917 Un_GL000195v1:81089-81111 GTGGGTTGCCACTGCTGGCTGGG - Intergenic
1188678079 X:32967570-32967592 TGGGTTTGCCACTGCGGGGAAGG - Intronic
1188972604 X:36636149-36636171 GTGGGTTGCCACTGGGGAGGGGG - Intergenic
1189896722 X:45664333-45664355 GTGGGTTGCCACTGCTGGCTGGG + Intergenic
1190718290 X:53123627-53123649 TTGGGATGGGACTGGGTGCAGGG - Intergenic
1191225691 X:58040586-58040608 GTGGGGTGCCATTGGGGGCAAGG - Intergenic
1191903599 X:66064530-66064552 TGGGGTTGCTAGAGGGGGCACGG - Intergenic
1192013400 X:67299858-67299880 CAAGGTTCCCACTGGGGGCATGG - Intergenic
1194155985 X:90389527-90389549 GTGGGTTGCCACTGCTGGCCGGG + Intergenic
1195259232 X:103116486-103116508 GTGGGTTGCCACTGCTGGCTCGG + Intergenic
1195551926 X:106181276-106181298 GTGGGTTGCCACTGCTGGCTGGG + Intronic
1195934461 X:110111684-110111706 TTTGGTTTTCACTGGGGGAAAGG - Intronic
1195974343 X:110509820-110509842 GTGGGCTGCCACTGAGGACATGG - Intergenic
1198061053 X:133045421-133045443 GTGGGTTGCCACTGCTGGCTCGG - Intronic
1199944267 X:152652915-152652937 TGGGCTTCCCACTGGGGCCATGG - Exonic
1201918926 Y:19213197-19213219 GTGGGTTGCCACTGCTGGCTGGG - Intergenic
1202100460 Y:21303001-21303023 GTGGGTTGCCACTGCTGGCTTGG + Intergenic