ID: 1174659539

View in Genome Browser
Species Human (GRCh38)
Location 20:52199588-52199610
Sequence CCACCACACTTGGCCAAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1146
Summary {0: 1, 1: 4, 2: 35, 3: 176, 4: 930}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174659539_1174659547 21 Left 1174659539 20:52199588-52199610 CCTATTTTGGCCAAGTGTGGTGG 0: 1
1: 4
2: 35
3: 176
4: 930
Right 1174659547 20:52199632-52199654 TTTTGGGAGGCTGAAGCAGGTGG 0: 117
1: 3367
2: 36096
3: 99919
4: 181490
1174659539_1174659542 4 Left 1174659539 20:52199588-52199610 CCTATTTTGGCCAAGTGTGGTGG 0: 1
1: 4
2: 35
3: 176
4: 930
Right 1174659542 20:52199615-52199637 TGCCTATAATCTCAGTATTTTGG 0: 6
1: 195
2: 3462
3: 33186
4: 157844
1174659539_1174659543 5 Left 1174659539 20:52199588-52199610 CCTATTTTGGCCAAGTGTGGTGG 0: 1
1: 4
2: 35
3: 176
4: 930
Right 1174659543 20:52199616-52199638 GCCTATAATCTCAGTATTTTGGG 0: 8
1: 264
2: 5581
3: 59447
4: 302308
1174659539_1174659546 18 Left 1174659539 20:52199588-52199610 CCTATTTTGGCCAAGTGTGGTGG 0: 1
1: 4
2: 35
3: 176
4: 930
Right 1174659546 20:52199629-52199651 GTATTTTGGGAGGCTGAAGCAGG 0: 13
1: 457
2: 9394
3: 88937
4: 221502
1174659539_1174659545 8 Left 1174659539 20:52199588-52199610 CCTATTTTGGCCAAGTGTGGTGG 0: 1
1: 4
2: 35
3: 176
4: 930
Right 1174659545 20:52199619-52199641 TATAATCTCAGTATTTTGGGAGG 0: 12
1: 365
2: 7584
3: 78650
4: 379265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174659539 Original CRISPR CCACCACACTTGGCCAAAAT AGG (reversed) Intronic
901559087 1:10055562-10055584 CCACCACACCCAGCCAACATGGG + Intronic
901624145 1:10614043-10614065 GCACCAGACTTGGAAAAAATAGG + Intronic
901732754 1:11292290-11292312 CCACCACACCTGGCCAGATCAGG + Intronic
901827711 1:11873339-11873361 CCACCACACCTGGCTAATCTGGG + Intergenic
901833214 1:11906747-11906769 CCACCGCACTCGGCCTAAAAAGG + Intergenic
901920706 1:12534798-12534820 CCACCACACCTGGCCCATTTGGG + Intergenic
902152310 1:14453240-14453262 CCACCGTGCCTGGCCAAAATAGG + Intergenic
902276158 1:15341027-15341049 CCACCACACCTGGCTAATTTTGG - Intronic
902868407 1:19296517-19296539 CCACCGCACCTGGCCACAAATGG + Intergenic
902895358 1:19476033-19476055 CCACCATGCCTGGCCAAAATTGG - Intronic
902988351 1:20169465-20169487 CCACCACACCTGGCCAGGAAAGG + Intronic
903203867 1:21765731-21765753 CCACCACACCCGGCCTAAATTGG - Intronic
903252893 1:22069461-22069483 CCACCACGCTTGGCCGAAACAGG + Intronic
903563085 1:24243686-24243708 CCACCGCGCCTGGCCAAACTGGG - Intergenic
903784851 1:25853442-25853464 CCACCACACCTGGCTAATTTTGG - Intronic
903961887 1:27063132-27063154 CCACCGCACCTGGCCAAGAAAGG - Intergenic
903985778 1:27227184-27227206 CCACCGCACTGGGCCTAGATTGG + Intergenic
904012425 1:27397515-27397537 CCACCACACCTGGCCAAGGGAGG - Intergenic
904188777 1:28726968-28726990 CCACCACACCCAGCTAAAATTGG + Intergenic
904771437 1:32883459-32883481 CCGCCACACTTGGCCAGAACTGG + Intergenic
904780495 1:32943322-32943344 CCACCACATCTGGCCTAAATGGG - Intronic
904793900 1:33044470-33044492 CCACCACACCTGGCTAATTTTGG - Intronic
905041532 1:34964009-34964031 CCACCACGCCTGGCCAAGAGTGG - Intergenic
905062296 1:35150112-35150134 CCACCGCACCTGGCCAGGATAGG + Intergenic
905411828 1:37775697-37775719 CCACCACACCTGGCCCAGATTGG + Intergenic
906092316 1:43191298-43191320 CCACCACGCCCGGCCAAAAGAGG - Intronic
906277650 1:44528899-44528921 CCACCACGTTTGGCCAGAATTGG + Intronic
906539334 1:46573060-46573082 TCACCACAATTGGACAAAATGGG + Intronic
906541215 1:46587528-46587550 CCACCACACCTGGCCATCATTGG - Intronic
906610093 1:47195473-47195495 CCACCACATCTGGCCGAAAGTGG - Intergenic
907028813 1:51150478-51150500 CCACCACGCCTGGCCATAAATGG + Intergenic
907048377 1:51313709-51313731 CCACCACACCTGGCCGAAGAAGG - Intronic
907090083 1:51715564-51715586 CCACCACACCTGGCCTAAGAGGG + Intronic
907090579 1:51721084-51721106 CCACCACACCTGGCTGAAATTGG + Intronic
907144403 1:52219400-52219422 CCACCACACTGGGCTAAAAGGGG - Intronic
907176309 1:52526735-52526757 CCACCACACCCAGCCAAGATTGG - Intronic
907195488 1:52683216-52683238 CCACCATGCCTGGCCAAAATGGG - Intergenic
907214600 1:52851548-52851570 CCACCACACCTGGCTAATTTTGG + Intronic
907421686 1:54352006-54352028 CCACCAGGCCTGGCCAAGATCGG - Intronic
908217550 1:61969844-61969866 CCACCACACCTGGCTAATTTTGG + Intronic
908221330 1:62009795-62009817 CCACCAGGCCTGGCCAAAAGTGG - Intronic
908270728 1:62419817-62419839 CCACCACGCTTGGTCAAACATGG + Intergenic
908545188 1:65155135-65155157 CCACCACACCCGGCCGACATAGG + Intronic
908754354 1:67454465-67454487 CCACCACGCCTGGCCAAGAAGGG + Intergenic
908760244 1:67505163-67505185 CCACCACGCCTGGCCTGAATTGG - Intergenic
908974121 1:69877298-69877320 CCACTACACTTGGCCCAGAGTGG - Intronic
909463414 1:75944845-75944867 CCACCACACCTGGCTTAAATAGG - Intergenic
909466874 1:75982558-75982580 TCACTACACTTCTCCAAAATGGG + Intergenic
909639794 1:77859597-77859619 CCACGACACTTTGTCAAAACAGG + Intronic
910057568 1:83050604-83050626 CCAAAACAATTGGCCAAAAGGGG + Intergenic
910879336 1:91908442-91908464 CCACCACGCTGGGCCAAAATTGG - Intergenic
910896702 1:92077486-92077508 CCACCACACCTGGCTAATTTTGG + Intergenic
911047808 1:93642938-93642960 CCACCACACCTGGCCCATATGGG - Intronic
911070749 1:93830173-93830195 CCACCACACCCGGCCAAACTGGG - Intronic
911128227 1:94361535-94361557 CCACCACACCTGGCCAAAACTGG + Intergenic
911176819 1:94825613-94825635 CCACCACACCCAGCCAAAAACGG + Intronic
911628525 1:100155898-100155920 CCACCACACCTGGCCAAAAGTGG - Intronic
911734298 1:101320557-101320579 CCACCACGCTTGGCCATAAAAGG + Intergenic
911804333 1:102186441-102186463 CCATCACACTCAGACAAAATAGG + Intergenic
912444258 1:109722724-109722746 CCACCACACCCTGCCCAAATTGG - Intronic
912747405 1:112256644-112256666 CCACCACTCTCTGCCAATATAGG - Intergenic
912809301 1:112781934-112781956 CCACCACGCCTGGCCAGACTGGG + Intergenic
913173245 1:116251123-116251145 CCACCGCACCTGGCCAATTTTGG - Intergenic
913223120 1:116675301-116675323 CCACCACACCTGGCTAATTTTGG + Intergenic
913283154 1:117204577-117204599 CCACCGCAACTGGCCAAAACAGG - Intronic
913343664 1:117785778-117785800 CTACCACACGTGGCCAAGAGTGG + Intergenic
913452621 1:119002261-119002283 TCACCCCAGTTGGACAAAATAGG - Intergenic
913970417 1:143411109-143411131 CCACCGCACCTGGCCAAGAAAGG - Intergenic
914064792 1:144236723-144236745 CCACCGCACCTGGCCAAGAAAGG - Intergenic
914114359 1:144729631-144729653 CCACCGCACCTGGCCAAGAAAGG + Intergenic
914262177 1:146008550-146008572 CCACCACACTTGGACAATCTTGG - Intergenic
914421311 1:147530890-147530912 CCACCACGCCTGGCCAATATGGG - Intergenic
915155185 1:153869837-153869859 TCACCACACCTGGCCCAATTTGG - Intronic
915223502 1:154393745-154393767 CCACCGCACCCGGCCAAATTGGG + Intergenic
915303483 1:154964751-154964773 CCACCACACCTGGCTAAACAAGG + Intronic
915512348 1:156393062-156393084 CCAACACACATGGCCAAGCTTGG + Intergenic
915577308 1:156788120-156788142 CCACCACACTTGGCTGTAATAGG + Intronic
915697615 1:157760329-157760351 CCACCACGCCTGGCCCCAATAGG - Intronic
916943461 1:169700422-169700444 CCACCACACCTGGCCAAAACAGG + Intronic
917239960 1:172937636-172937658 CCACCACACCTGGCTAATCTTGG + Intergenic
917284378 1:173408875-173408897 CCACTGCACCTGGCCAGAATGGG + Intergenic
917372751 1:174313212-174313234 CCACCACACCTGGCCATAAATGG + Intronic
917908206 1:179611201-179611223 CCACCATACTTGGCTAATTTTGG + Intronic
918124893 1:181574737-181574759 CCACCATACCTGGCCAACAATGG - Intronic
919070622 1:192751091-192751113 CCACCGCGCTTGGCCAATAAAGG + Intergenic
919585043 1:199427229-199427251 CCACCACGCCTGGCCACAGTCGG - Intergenic
919634870 1:199993764-199993786 CCATCACACCTGGCCAAAATTGG - Intergenic
919645773 1:200093189-200093211 CCACCACACCCGGCCAACATAGG + Intronic
919687514 1:200498022-200498044 CCACCACACCTGGCTAATTTTGG + Intergenic
920863538 1:209731992-209732014 CCACCACACCTGGCCAGGACAGG + Intronic
921021061 1:211236173-211236195 CCACCACGCTTGGCTTAAGTTGG - Intergenic
921539178 1:216392209-216392231 CCACCACACCTGGCCAGGATTGG - Intronic
922417485 1:225434753-225434775 CCACCGCACCTGGCCAGAATGGG - Intergenic
922804776 1:228379610-228379632 CGACCCCTCTTGGCTAAAATGGG + Intergenic
922890393 1:229057623-229057645 ACAGCACACTTGGCCATTATGGG + Intergenic
923702895 1:236316788-236316810 CCACTGCACCTGGCCCAAATTGG - Intergenic
924122946 1:240821163-240821185 CCACCACACCCGGCCAAGAGGGG - Intronic
924536431 1:244939736-244939758 CCACCGCACCTGGCCTAAAGCGG + Intergenic
924537240 1:244946176-244946198 CCACCACGCTTGGCCAATTTTGG + Intergenic
924885568 1:248211756-248211778 CCATGCCACTTGGCCAAATTAGG - Intergenic
1062785853 10:264105-264127 CCACCACGCCTGGCCACAAGTGG + Intergenic
1062968895 10:1630800-1630822 CCACCACACCTGGCTAATTTTGG - Intronic
1063160244 10:3413391-3413413 CCACCACACCTGGCTAATTTTGG - Intergenic
1063967327 10:11356636-11356658 CCACCACACCTGGCTAATTTTGG - Intergenic
1064085411 10:12342502-12342524 CCACCACGCTTGACCATAAAAGG - Intergenic
1064152077 10:12873656-12873678 CCACCACACCCGGCCAAGCTGGG - Intergenic
1064451191 10:15443470-15443492 CCACCACACGTGGCTAATTTCGG + Intergenic
1064459840 10:15523620-15523642 CCACCACACCTGGCCCAAAGTGG - Intronic
1064475063 10:15679295-15679317 CCACCACAACTGGCCATAATAGG - Intronic
1064528797 10:16285408-16285430 CCACCGCACCTGGCCCAGATGGG + Intergenic
1064706459 10:18077508-18077530 CCACCACACCTGGCCCACTTGGG - Intergenic
1064790142 10:18949830-18949852 CCACCATGCCTGGCCAAAACAGG + Intergenic
1064831050 10:19467065-19467087 CCACCACACCTGGCCAAGAAAGG - Intronic
1065006279 10:21383209-21383231 CCACCGCGCCTGGCCAAAAGAGG + Intergenic
1065298945 10:24303301-24303323 CCACCACACCTGGCCTCCATTGG + Intronic
1065413120 10:25452331-25452353 CCACGATACCTGGCCAAAATTGG + Intronic
1065722806 10:28642859-28642881 TCACCACACCTGGCTAATATTGG - Intergenic
1065731508 10:28713538-28713560 CCACCGCGCCTGGCCATAATGGG - Intergenic
1065834208 10:29642109-29642131 CCACCGCACCTGGCCAGATTAGG - Intronic
1066361578 10:34736962-34736984 CCACCATGCCTGGCCAAAATAGG + Intronic
1066373277 10:34835634-34835656 CCACCACACCTGGCTAATTTTGG + Intergenic
1066412560 10:35187790-35187812 CCACCACACCTGGCCTTAAATGG + Intronic
1067014150 10:42743508-42743530 CCACCATGCCTGGCCAAAAATGG + Intergenic
1067075077 10:43173838-43173860 CCACCACACCTGGCTAATTTTGG - Intronic
1067096936 10:43307606-43307628 CCACCATGCCTGGCCAAAACTGG - Intergenic
1067101097 10:43335307-43335329 CCACCGCACTCGGCCAAAATTGG - Intergenic
1067115378 10:43431796-43431818 CCACCACACTCAGCCACATTTGG + Intergenic
1067329009 10:45296876-45296898 CCACCACACCTGGCCACATGTGG + Intergenic
1068710281 10:60126396-60126418 CCACCACACCTGGATAAACTTGG - Intronic
1068884154 10:62081088-62081110 CTACCACACTTGGCCAGTAGTGG + Intronic
1069246422 10:66212714-66212736 CCACCATGCTTGCCCAAAAAAGG - Intronic
1069519375 10:69106362-69106384 CCACCACACCTGGCCAGCATCGG - Intergenic
1070121251 10:73579465-73579487 CCACTGCGCCTGGCCAAAATTGG - Intronic
1070186341 10:74066344-74066366 CCACCACGCCTGGCCAATTTTGG + Intronic
1070904153 10:80056978-80057000 CCACCACACCTGGCTAATTTTGG - Intergenic
1071416985 10:85450551-85450573 CCACCACACCTGGCCAGTGTGGG + Intergenic
1071475577 10:86022628-86022650 CCACTGCACCTGGCCAAAAAAGG - Intronic
1071553045 10:86581996-86582018 GCACCACACCTGGCCATAAATGG + Intergenic
1071686716 10:87765740-87765762 CCACCACAGCTGGTCAAAAATGG - Intronic
1071687424 10:87774798-87774820 CCACCACACCTGGCTAATTTTGG - Intronic
1072107066 10:92284322-92284344 CCACCACGCCCGGCCAGAATGGG + Intronic
1072593132 10:96845752-96845774 CCACCGCACCCGGCCAAAATGGG + Intronic
1072625528 10:97108601-97108623 CCACCACACCTGGCCAAATGTGG - Intronic
1072742780 10:97920034-97920056 CCACCACACCTGGCCTAACATGG + Intronic
1072958799 10:99910950-99910972 CCACCACACTTGGCCTAAAATGG - Intronic
1072979763 10:100090120-100090142 CCACCACGCCCGGCCTAAATTGG + Intergenic
1073086859 10:100896600-100896622 CCACCGCACCTGGCCAAAGCTGG + Intergenic
1073348777 10:102804099-102804121 TCACCACACCTGGCCAACTTAGG - Intronic
1073405828 10:103296979-103297001 CCACCACACCTGGCCTACAGCGG + Intergenic
1073937659 10:108653204-108653226 CAGCCACACATGGCCCAAATTGG - Intergenic
1074627251 10:115203882-115203904 CCACCGCACCTGGCCTAGATTGG + Intronic
1074788892 10:116866534-116866556 CTACCACACTTGGCCAAGACAGG - Intronic
1074947990 10:118299666-118299688 CGACCACACTTGGCCCAGAAAGG + Exonic
1075148133 10:119900745-119900767 CCACCACACCTGTCCCAAAATGG + Intronic
1075338889 10:121629761-121629783 CCACCGCACCTGGCCCATATTGG + Intergenic
1075590383 10:123686965-123686987 CCAGCACCCTTGGCCATATTTGG - Intronic
1076663635 10:132072191-132072213 CCACCACACCTGGCCTAAAGTGG + Intergenic
1077019228 11:410184-410206 CCCTCACACGTGGCCAGAATGGG + Intronic
1077813996 11:5667484-5667506 CCACCACACCTGGCCAAATCTGG + Intronic
1078240024 11:9522779-9522801 CCACCACACCTGGCCTATTTGGG + Intronic
1078634402 11:13035385-13035407 CCTCCACACATGGCCAACACAGG - Intergenic
1079060843 11:17247605-17247627 CCACCACGCTTGGCCAATTTGGG - Intronic
1080044779 11:27797524-27797546 CCACCGCGCTTGGCTGAAATAGG - Intergenic
1080510855 11:32969835-32969857 CCACCACACCTGGCTAATTTTGG + Intronic
1080519629 11:33056396-33056418 CCACCACACCTGGCCAATACTGG + Intronic
1080639086 11:34148302-34148324 CCACCACACTTGGCCAGGACTGG + Intergenic
1080835513 11:35936970-35936992 CCACCACGCCTGGCCACAAATGG - Intergenic
1080897495 11:36458813-36458835 CCACCACACTTGGACAGGAGGGG - Intronic
1081892293 11:46553457-46553479 CCACTGCACCTGGCCAAACTTGG - Intronic
1082282644 11:50286751-50286773 CCACCACACCTGGCTAATTTTGG - Intergenic
1082831773 11:57623700-57623722 CCACCACACCTGGCCAACTTCGG - Intergenic
1082916422 11:58443311-58443333 CCACCGCGCCTGGCCAAACTTGG - Intergenic
1083565175 11:63708449-63708471 CCACCATACCTGGCCTAAATAGG + Intronic
1083643505 11:64158528-64158550 CCACCACGCCTGGCCCAAAGTGG + Intronic
1083951340 11:65958230-65958252 CCACCACGCCTGGCCAAATTGGG + Intronic
1083960163 11:66010588-66010610 CCACCACACCTGGCAATTATTGG + Intergenic
1084060833 11:66672914-66672936 CTACTACACTTGGACAAAGTAGG + Intronic
1084378032 11:68791822-68791844 CCACCGCGCCTGGCCAGAATGGG + Intronic
1084392759 11:68889523-68889545 CCACCACACCCAGCCAATATTGG + Intergenic
1084821191 11:71692107-71692129 CCACCACACGTGGCTAATTTTGG + Intergenic
1084875679 11:72130998-72131020 CCACCACGCCCGGCCAAGATGGG - Intronic
1084881584 11:72175278-72175300 CCATCACGCCTGGCCAATATTGG - Intergenic
1084985829 11:72870611-72870633 CCACCGCACCTGGCCCAAAGGGG - Intronic
1085543635 11:77296770-77296792 CCACCGCACCCGGCCAAAAAAGG - Intronic
1085591062 11:77761224-77761246 CCACCGCACCTGGCCACATTAGG + Intronic
1085607793 11:77918282-77918304 CCACCACACCTGGCTAATTTTGG - Intronic
1086109478 11:83183775-83183797 CCACCGTGCTCGGCCAAAATAGG + Intronic
1086204617 11:84242691-84242713 CCACCGCACCTGGCCAAAATAGG + Intronic
1086846527 11:91756417-91756439 CCACCACACTTAGCCTAATATGG - Intergenic
1086965120 11:93019405-93019427 CCACCATGCCTGGCCAATATAGG + Intergenic
1087463535 11:98474979-98475001 CCACCACACATGGCGATTATGGG + Intergenic
1088610034 11:111568096-111568118 CCACCACGCCTGGCCAAAATTGG - Intergenic
1088646071 11:111917513-111917535 GCACCACACCTGGCCAAGATAGG - Intronic
1089122726 11:116148957-116148979 CCACCACACCTGGCTAAGAAAGG + Intergenic
1089212509 11:116815283-116815305 CCACCACACCTGGCCTAAAATGG + Intergenic
1090356204 11:126141972-126141994 CCACCACACCTGGCCAAGGGGGG - Intergenic
1090960800 11:131555007-131555029 CCACCACACATGGCCCATAATGG - Intronic
1091087428 11:132735768-132735790 CCACCGCACCTGGCCACAAAAGG + Intronic
1091363554 11:134998275-134998297 CCACCACACTTGGTTAATTTTGG - Intergenic
1091601383 12:1919570-1919592 CCACCACACATGGCCAGGGTGGG - Intergenic
1091644153 12:2260941-2260963 CCACACCACCTGGCCACAATCGG - Intronic
1091729940 12:2873244-2873266 CCACCACACCTGGCTAATTTTGG - Intronic
1092458400 12:8665289-8665311 ACACCACACCTGGCCAAGGTTGG + Intergenic
1092525697 12:9308677-9308699 CCACCACGCCTGGCCCATATTGG + Intergenic
1092541589 12:9423138-9423160 CCACCACGCCTGGCCCATATTGG - Intergenic
1092750912 12:11718476-11718498 CCACCACACCTAGCCAACCTGGG - Intronic
1092832953 12:12462933-12462955 CCACCACGCCTGGCCAAGCTGGG + Intronic
1093005285 12:14044529-14044551 CCCCCACACTGGGCCTAAAGTGG + Intergenic
1093155166 12:15675445-15675467 CCACCACACCTGGCTAATTTTGG - Intronic
1093454598 12:19352701-19352723 CCACAGCACCTGGCCAAAAGAGG + Intronic
1093602003 12:21038562-21038584 CCCCCACACTTGGCTAATTTTGG - Intronic
1093630851 12:21407511-21407533 CCACTGCACCTGGCCCAAATAGG - Intronic
1094189929 12:27687793-27687815 CCACTATACTTGGCCAGAAAAGG - Intronic
1094256086 12:28428281-28428303 CCACTACGCGTGGCCAAAAAGGG - Intronic
1094354740 12:29565692-29565714 CCACCACACCTGGCTAATTTTGG - Intronic
1094355206 12:29570554-29570576 CCACCACACCTGGCCTAATATGG - Intronic
1094511453 12:31099364-31099386 CCACCACGCCTGGCCCATATTGG + Intronic
1094607716 12:31963190-31963212 CCACCACACCTGGCTAATTTTGG - Intronic
1094622423 12:32092769-32092791 CCACCGCACCCGGCCCAAATTGG + Intergenic
1095145204 12:38719314-38719336 CCACCACACCCAGCCAAATTGGG - Intronic
1095575991 12:43739981-43740003 CCAACACACATGACAAAAATAGG + Intronic
1096422185 12:51468470-51468492 CCACCACACCCGGCCAGAAATGG - Intronic
1096723130 12:53539289-53539311 CCACCACACTTGGCCTATGAGGG - Intronic
1096723153 12:53539404-53539426 CCACCACACCTGTCCAAGAAAGG - Intronic
1096800143 12:54105196-54105218 CCACCACACCTGGCTAACACCGG - Intergenic
1097250462 12:57629900-57629922 CCCCCACAGTTGGCCTAAAGGGG + Intronic
1097439191 12:59588405-59588427 CCACCACACTCAGCCAAAAGAGG + Intergenic
1098124401 12:67275237-67275259 CCACCACACAAGACCTAAATTGG - Intronic
1098189727 12:67935412-67935434 CCACCACACCCGGCCAACCTTGG - Intergenic
1098398433 12:70047211-70047233 CCCTCACACCTGCCCAAAATTGG - Intergenic
1099460775 12:82918194-82918216 CCACTGCGCCTGGCCAAAATTGG + Intronic
1099686664 12:85898529-85898551 CCACCGCACCTGGCCACAGTTGG - Intergenic
1099786705 12:87273702-87273724 CCACCACACCTGGCTAATTTTGG + Intergenic
1099841962 12:87977238-87977260 CCACCACACCTGGCTAATTTTGG - Intergenic
1100385902 12:94104482-94104504 CCACCGCACCTGGCCAAAACTGG - Intergenic
1100426482 12:94491885-94491907 TCTCCACACTAGCCCAAAATTGG + Intergenic
1100460454 12:94794250-94794272 CCACCACACCTGGCTAATTTTGG + Intergenic
1100636468 12:96439246-96439268 CCACCACTCCTGGCTAAATTTGG - Intergenic
1100977257 12:100135419-100135441 CCACCACGCTCGGCCAATTTTGG + Intronic
1100993884 12:100281397-100281419 CCACCACACCTAGCCCAAATTGG - Intronic
1101523906 12:105510163-105510185 CCACCACACCTGGCCTGACTGGG - Intergenic
1101789806 12:107916247-107916269 CCACCACACCTGGCCCAGACTGG - Intergenic
1101853412 12:108422659-108422681 CCACCACACCCGGCCAAGACTGG + Intergenic
1101868768 12:108544850-108544872 CCACCGCACTTGGCCAACTCTGG + Intronic
1101964706 12:109274536-109274558 CCACTGCACCTGGCCAAGATGGG + Intergenic
1101968291 12:109295496-109295518 CCACCACACCCGGCCAGAGTTGG - Intronic
1102103289 12:110298430-110298452 CCACCACGCCTGGCCAAAACAGG - Intronic
1102165012 12:110799098-110799120 CCACCACACCTGGCTAATTTTGG + Intergenic
1102874253 12:116437382-116437404 CCACCGCACCTGGCCAACAACGG - Intergenic
1102918051 12:116769880-116769902 CCACCACACCTGGCTAATTTTGG - Intronic
1102948172 12:117008912-117008934 CCACCACACCTGGCTAATTTTGG - Intronic
1103001859 12:117390866-117390888 CCACCACGCCTGGCCAACCTTGG + Intronic
1103130713 12:118466248-118466270 CCACCACGCCTGGCCAATTTCGG - Intergenic
1103232718 12:119345347-119345369 CCACCACACCTGGCTAATTTTGG - Intronic
1103308358 12:119985253-119985275 CCCCCACACTTGGCTAATTTTGG - Intergenic
1103370629 12:120416569-120416591 CCACCACACCTGGCTAATTTTGG - Intergenic
1103395237 12:120602016-120602038 CCACCACGCCTGGCCAAATAGGG + Intergenic
1103471550 12:121185766-121185788 CCACCACACCTGGCCAGGATAGG - Exonic
1104433661 12:128738228-128738250 CCACCACACCTGGCCAACATGGG + Intergenic
1105444780 13:20443678-20443700 CCACCACACCTGGCCAACCCAGG + Intronic
1106271617 13:28159733-28159755 TCACCACACCTGGCCAATACTGG + Intronic
1106791883 13:33163435-33163457 CCACCACACCTGGCTAATTTTGG - Intronic
1106839331 13:33669819-33669841 CCACCACACCCGGCCAGAAGAGG + Intergenic
1107503034 13:41000506-41000528 CCACCACACTGGGCCGAACCTGG + Intronic
1107542128 13:41398717-41398739 CTACCAGTCTAGGCCAAAATTGG - Intergenic
1108135547 13:47353907-47353929 CCACCACACCCGGCCATGATTGG - Intergenic
1108540502 13:51440103-51440125 CCACCACACCTGGCTAATTTTGG - Intronic
1108827725 13:54435124-54435146 CCACCACGCCTGGCCAAAGATGG + Intergenic
1109121393 13:58462163-58462185 CCACCACGCTCGGCCAAGGTAGG + Intergenic
1110497770 13:76189757-76189779 CCACCACACCTGGCCTAGAATGG - Intergenic
1111015449 13:82374367-82374389 CCACCACACCTGGCCTTATTTGG - Intergenic
1111483457 13:88863963-88863985 CCACCGCGCCTGGCCTAAATGGG - Intergenic
1111601466 13:90480638-90480660 CCACCACACTTGGCCATTGTTGG + Intergenic
1111704657 13:91733285-91733307 CCACCACACCTGGCTAATTTTGG + Intronic
1111729791 13:92058829-92058851 CCACCGCCCTTGGCCAGAATTGG + Intronic
1111940149 13:94599702-94599724 CCACCACACCTGGCTAATTTTGG - Intergenic
1111994502 13:95151192-95151214 CCACCACACTAGACCAACAATGG - Intronic
1112005605 13:95251073-95251095 CCACCAAGCTTGGCCAATAGTGG + Intronic
1112117345 13:96370622-96370644 CCACCACACCTGGCCAATAATGG - Intronic
1112898840 13:104335305-104335327 CCACCACACCTGGCCGAGAGTGG + Intergenic
1113009033 13:105742154-105742176 CCACCCCACCCGGCCAAATTAGG + Intergenic
1113942499 13:114025559-114025581 CCACCACACCAGGCCAGCATGGG - Intronic
1114279610 14:21179592-21179614 CCACCACACCTGGCCTATTTTGG + Intergenic
1114290144 14:21281307-21281329 CCACCACACCTGCCCAATCTTGG + Intergenic
1114574122 14:23696879-23696901 CCACCACAGTTGGCTGAAACCGG + Intergenic
1114638086 14:24200015-24200037 CCACCACACCTAGCTAATATTGG + Intronic
1114716126 14:24826910-24826932 CCACCACACCTGGCCAAAATAGG - Intronic
1115384401 14:32779106-32779128 CCACCACATCTGGCCTAAATTGG - Intronic
1115407412 14:33033188-33033210 CACCCACACCTGGCCCAAATAGG - Intronic
1115616278 14:35097897-35097919 CCACCACACCTAGCCCAGATTGG + Intronic
1115620632 14:35136660-35136682 CCACCGCACCTGGCCCATATTGG + Intronic
1115637434 14:35304258-35304280 CCACCACGCCTGGCCAAGCTAGG + Intronic
1115965238 14:38880179-38880201 CCACTGCACCTGGCCAAAACAGG + Intergenic
1116014606 14:39391534-39391556 CCACCACACCTGGCCTGAAGTGG - Intergenic
1116180466 14:41526046-41526068 CCACCACACCTGGCCCAGACTGG - Intergenic
1116446448 14:45017594-45017616 CCACCACGCCTGGCCAAGAATGG - Intronic
1116461980 14:45188049-45188071 CCACCGCACATGGCCAAAAAGGG - Intronic
1116663421 14:47742536-47742558 CCACCACACCTGGCTAACTTGGG - Intergenic
1116774390 14:49163420-49163442 CCACCACACCAGGCCAACACAGG + Intergenic
1116886515 14:50227394-50227416 CCACCACACTTGGCTAATTTTGG + Intronic
1116941241 14:50792990-50793012 CCACCACAATTGGCAAACAGTGG - Intronic
1116994232 14:51305577-51305599 CCACCACACCTGGCTAATTTTGG - Intergenic
1117147506 14:52849837-52849859 CCACCGCACCTGGCCAAACCAGG + Intergenic
1117442927 14:55777025-55777047 CCACCACACCTGGCTAATTTTGG - Intergenic
1117682882 14:58223423-58223445 CCACTGCACCTGGCCAAAACAGG + Intronic
1118187270 14:63549050-63549072 CCACCACACCTGGCCAGATAAGG - Intergenic
1118202003 14:63683342-63683364 CCACCACACTTGGCCACGTTAGG + Intergenic
1118263523 14:64270795-64270817 CCACCACAGCTGGCCAGAAGAGG + Intronic
1118278632 14:64408665-64408687 CCACCACACTTGGCCAGTATAGG - Intronic
1118779340 14:68996441-68996463 CCACCACACTTGGCCAGCTGTGG - Intergenic
1119283791 14:73433800-73433822 CCACCGCGCCTGGCCTAAATCGG - Intronic
1119349095 14:73949644-73949666 CCACCACGCCCGGCCAAATTTGG + Intronic
1119369887 14:74130563-74130585 CCACCACACCTAGCCTAAATTGG + Intronic
1119710735 14:76821363-76821385 CCACCACACCTAGCTAAGATAGG + Intronic
1120202976 14:81557936-81557958 CCACCACACCTGGCTAATTTTGG + Intergenic
1120687482 14:87554894-87554916 CCACCACGCCTGGCCAGAAAAGG - Intergenic
1120934198 14:89877190-89877212 CCACCACACCTGGCTAATTTTGG + Intronic
1120962932 14:90141608-90141630 CCACCACACCTGGCTAATTTTGG + Intronic
1121096029 14:91218688-91218710 CCACCACACCTGGCCTAAAATGG + Intronic
1121106392 14:91282771-91282793 CCACTACACCTGGCCAAGAAAGG - Intronic
1121189161 14:92009318-92009340 CCACCACACTCGGCCCTCATAGG + Intronic
1121195859 14:92071306-92071328 CCACCACTCCTGGCCATGATAGG - Intronic
1121297630 14:92842474-92842496 CCAGCACACCTGGCCCAAAATGG - Intergenic
1121432370 14:93896647-93896669 CCACCACACCTGGCCAAGAATGG + Intergenic
1121651906 14:95564911-95564933 CCACCACACCTGGCCACACCTGG - Intergenic
1121712477 14:96049124-96049146 CCACCACACCTGGCCCAACATGG - Intronic
1121997981 14:98620114-98620136 CCACAAACCTTGGCCAAAAATGG - Intergenic
1122072608 14:99214263-99214285 CCACCACACCTGGCCACACCTGG - Intronic
1122470318 14:101961885-101961907 CCACCACACCTGGCCAAATGTGG + Intergenic
1122748370 14:103914510-103914532 CCACAACACCTGGCCCAATTGGG - Intronic
1124354913 15:28987908-28987930 CCACCACACCTGGCTAATTTGGG + Intronic
1124444953 15:29722357-29722379 GCTCCAGACATGGCCAAAATGGG + Intronic
1124930668 15:34116193-34116215 CCACCACACCTGGCCCAAACAGG + Intergenic
1124935048 15:34162201-34162223 CCACAACACTTGGCAATTATGGG - Intronic
1125022510 15:34999238-34999260 CCACCACGCCTGGCCACCATTGG - Intergenic
1125032967 15:35091386-35091408 CCACCACACCTGGCCAGATTAGG - Intergenic
1125069415 15:35534088-35534110 CCACCGCTCCTGGCCAATATTGG - Intronic
1125072564 15:35573431-35573453 CCACCGCACCTGGCCCCAATAGG - Intergenic
1125660047 15:41386828-41386850 CCACCACACCTGGCTAACTTTGG + Intergenic
1125692662 15:41608980-41609002 CCACCACACCTGGCCCACACTGG + Intergenic
1125706399 15:41741059-41741081 CCACCGCGCCCGGCCAAAATAGG - Intronic
1125857322 15:42962775-42962797 CCACCACGCCTGGCCAACACTGG + Intronic
1126028308 15:44470733-44470755 CCACCACGCCTGGCCTACATTGG + Intronic
1126147981 15:45494998-45495020 CCACCACACTTGGCCAATTTTGG - Intronic
1126349787 15:47732534-47732556 CCACCTCAGTTGACCCAAATGGG + Intronic
1126445024 15:48732823-48732845 CCACCAGACCTGGCCACATTTGG - Intronic
1126807858 15:52370823-52370845 CCACTACACCTGGCCAACTTGGG - Intronic
1127580054 15:60329937-60329959 CCACCACACCTGGACAATTTTGG - Intergenic
1127839054 15:62814093-62814115 CCACCAGGCCTGGCCAATATGGG + Intronic
1127915091 15:63448839-63448861 CCACCACACCTGGCCCTATTTGG - Intergenic
1128035102 15:64517930-64517952 CCACCACACCTGACCAATTTTGG + Intronic
1128143320 15:65317323-65317345 CCACCACACCTGGCTAATTTTGG - Intergenic
1128307931 15:66612200-66612222 CCACCACACTTGGCCTGATGAGG - Intronic
1128600672 15:68992995-68993017 CCACCACAGTTGGCTGAAACTGG - Intronic
1129078202 15:73015644-73015666 CCACCACACCTGGCCTGAACAGG + Intergenic
1129315778 15:74742900-74742922 CCACCACACCTGGCCACCACTGG - Intergenic
1129593453 15:76938877-76938899 CCACCACACCTGGCCTGAATGGG - Intronic
1129750663 15:78060762-78060784 CCACCACACCTGGCTAATTTTGG - Intronic
1130225136 15:82051211-82051233 CCACCGCACATGGCCAACAATGG + Intergenic
1130308942 15:82735867-82735889 CCACCACACCTGGCCTACATTGG - Intergenic
1130763564 15:86846817-86846839 CCACCACACCCAGCCAAATTTGG + Intronic
1131145755 15:90010579-90010601 CCACCGCACCTGGCCAAAACAGG + Intronic
1131253262 15:90844846-90844868 CCACCACGCCTGGCTAAAACTGG + Intergenic
1131275836 15:90980096-90980118 CCACCACACCCAGCCAAAAGTGG - Intronic
1131635108 15:94224498-94224520 CCACCACATCTGGCCACTATGGG + Intergenic
1132126811 15:99234657-99234679 CCACCGCACCTGGCCAAAAATGG + Intronic
1132382433 15:101375745-101375767 CCACCACACCTGGCCAGAAATGG - Intronic
1132600784 16:771903-771925 CCACTGCACCTGGCCAAATTGGG - Intronic
1132979806 16:2731495-2731517 CCACCGCGCCTGGCCAAAAATGG + Intergenic
1133149235 16:3814542-3814564 CCACCACGCCTGGCCATAACTGG + Intronic
1133175725 16:4012824-4012846 CCATCACTCTTTTCCAAAATGGG - Intronic
1133180970 16:4054374-4054396 CCACCACAGTTTGGGAAAATCGG - Intronic
1133457572 16:5956121-5956143 CCACCACACCTGGCTAATTTTGG - Intergenic
1133805246 16:9121766-9121788 CCACCACGCCTAGCCAAAAAGGG - Intergenic
1134114315 16:11536592-11536614 CCACCACACCTGGCCACATGTGG + Intergenic
1134170823 16:11968187-11968209 CCACCGCGCCTGGCCAAAACTGG - Intronic
1134766488 16:16763279-16763301 CCACCATGCCTGGCCAAAAAAGG + Intergenic
1134908666 16:18004460-18004482 CCACCGCACCTGGCCAAGCTGGG + Intergenic
1135152368 16:20020007-20020029 CCACCACACCTGGCCCAAGATGG + Intergenic
1135505585 16:23033285-23033307 CCACCACACCTGGCCCCAATAGG - Intergenic
1135642640 16:24134306-24134328 CCACCACACCTGGCCTCATTAGG - Intronic
1135784076 16:25332316-25332338 CCACCACACCTGGCTAATTTTGG - Intergenic
1136405110 16:30040806-30040828 CCACCACACCTGGCTAATCTGGG + Intronic
1136526221 16:30832878-30832900 CCACCACACTCAGCCTAAACTGG + Intergenic
1136538892 16:30917339-30917361 CCACCACACGAGGCCAATAGCGG - Intergenic
1137284716 16:47005703-47005725 CCACCACACCCGGCCCAGATAGG + Intergenic
1137413513 16:48249902-48249924 CCACCACACCTGGCCAAAAGGGG - Intronic
1137664003 16:50237607-50237629 CCACCACACCTGGCTAAGACAGG - Intergenic
1138373919 16:56549375-56549397 CTGCCAAACTTGGCCAAACTTGG + Intergenic
1139398405 16:66659405-66659427 CCACCAGTCAAGGCCAAAATGGG + Intronic
1139401809 16:66687972-66687994 CCACCGCGCCTGGCCAAAATGGG + Intronic
1139443663 16:66982840-66982862 CCACCACACTCAGCCCAGATTGG - Intergenic
1139465800 16:67153389-67153411 CCACCGCACCTGGCCAAGACTGG - Intergenic
1139742419 16:69046605-69046627 CCACCGCACCTGGCCAGAAAAGG + Intronic
1139904943 16:70358181-70358203 CCACCACACCTGGCTAATTTTGG + Intronic
1140070297 16:71643385-71643407 CCACCACACCTGGCCAGAAATGG - Intronic
1140116420 16:72045626-72045648 CCTCCACACCTGGCCAATAATGG - Intronic
1140211633 16:72975152-72975174 CCACCACACCTGGCCCTGATAGG - Intronic
1140565018 16:76031706-76031728 CCACCACACCTGGCCTAGAATGG + Intergenic
1141095556 16:81160407-81160429 CCACCACACTTGGCTGAAAGTGG + Intergenic
1142052519 16:87968039-87968061 CCACCACGCCTGGCCAGAAAAGG + Intronic
1142163852 16:88574494-88574516 CCACCACGCCTGGCCAGATTTGG + Intronic
1142188873 16:88708099-88708121 CCACCACACCTGGCCAAGATAGG + Intronic
1142361233 16:89628207-89628229 CCACCACACCCGGCCACAAAAGG + Intronic
1142972238 17:3620711-3620733 CCACCACACCTGGCTAATTTTGG + Intronic
1143069738 17:4280918-4280940 CCACCGCACCTGGCCACAAAGGG + Intronic
1143214983 17:5218176-5218198 CCACCACACCTGGCTAATTTTGG + Intronic
1143229728 17:5342970-5342992 CCACCACACTCAGCCAAAAAGGG - Intronic
1143236989 17:5411274-5411296 CCACCGTGCTTGGCCAATATTGG - Intronic
1143416954 17:6757288-6757310 CCACCACACCCAGCCAAAAGGGG + Intronic
1143580037 17:7820094-7820116 CCACCACGCCTGGCAAAAACTGG + Intronic
1143604633 17:7975483-7975505 CCACCACACTTGGCCAAAACTGG - Intergenic
1144123853 17:12182792-12182814 CCACCACGCCTGGCCAATTTTGG + Intergenic
1144144285 17:12382250-12382272 CCACCACGCCTGGCTAAACTGGG - Intergenic
1144196634 17:12901209-12901231 CCACCACACCCGGCCAAGTTTGG + Intronic
1144429556 17:15178809-15178831 CCACCACACCCGGCCACACTAGG - Intergenic
1144560723 17:16318643-16318665 CCACCACACCTGGCCAAAGCTGG - Intronic
1144810066 17:17993331-17993353 CCACCACACCTGGCTAATTTTGG - Intronic
1145217525 17:21063212-21063234 CCACCACACCTGGCTAATTTTGG + Intergenic
1145901696 17:28494175-28494197 CCACCACACTTGGCAGGAGTAGG + Intronic
1145918148 17:28588967-28588989 CCACCACATTGGGCCAACAGTGG + Intronic
1145950172 17:28811151-28811173 CCACCGCGCCTGGCCTAAATGGG - Intronic
1146083462 17:29804979-29805001 CTACCACACCTGGCCATAAAAGG + Intronic
1146099250 17:29963227-29963249 CCACCACACCTGGCCAACTGTGG + Intronic
1146173266 17:30648921-30648943 CCACCGCACCTGGCCGGAATTGG - Intergenic
1146175114 17:30661096-30661118 CCATCACACCTGGCTAGAATGGG + Intergenic
1146348567 17:32077130-32077152 CCATCACACCTGGCTAGAATGGG + Intergenic
1146378188 17:32308911-32308933 CCACCACACCTGGCTAATTTTGG - Intronic
1146454456 17:32998068-32998090 CTACCACACCTGGCAAAATTTGG + Intergenic
1146710875 17:35040312-35040334 CCACCACACCCGGCCAAGAAAGG - Intronic
1146784841 17:35710781-35710803 CCACCATACTTGGCCCAACGAGG - Intronic
1147294923 17:39474600-39474622 CCACCACTCCCGGCCAATATTGG + Intronic
1147300007 17:39518845-39518867 CCACCACACCTAGCCAGAATTGG + Intronic
1147634925 17:41958062-41958084 CCACCACACCCGGCCTAAACAGG + Intronic
1147798170 17:43060792-43060814 CCACCACACACGACCAACATTGG + Intronic
1147960620 17:44165444-44165466 CCACCACGCCTGGCCACACTTGG - Intergenic
1147960702 17:44165943-44165965 CCTCCACACCTGGCCCAAACCGG - Intergenic
1148256976 17:46143339-46143361 CCACCACACCTGGCTAATTTTGG - Intronic
1148382214 17:47208279-47208301 CCAGCACACTTGGCTAATTTTGG - Intronic
1148448913 17:47761119-47761141 CCACCACACCCAGCCAGAATTGG + Intergenic
1148670974 17:49409821-49409843 CCACCGCACCTGGCCACAAGTGG + Intronic
1148812068 17:50299669-50299691 CCACCACACCTGGCCAGCCTTGG + Intergenic
1148922897 17:51054721-51054743 CCACCGCACCTGGCCAAATGTGG + Intronic
1149007647 17:51822134-51822156 CCACCACACCTGGCCAAGGATGG - Intronic
1149150889 17:53562385-53562407 CCACCGCCCTTGGGCAAAAGAGG - Intergenic
1149741165 17:59046865-59046887 CCACCGCACCTGGCCAATCTGGG - Intronic
1149741923 17:59054951-59054973 CCACCACACCTGGCTAAATAGGG + Intronic
1150412876 17:64961607-64961629 CCACCACACCTGGCTAATTTTGG - Intergenic
1150754465 17:67898765-67898787 CCACCTCACCTGGCCAATAGTGG - Intronic
1150798961 17:68263620-68263642 CCACCACACCTGGCTAATTTTGG + Intronic
1150939409 17:69674156-69674178 CCACCACACCTAGCCCAAATTGG + Intergenic
1151169683 17:72236353-72236375 CCACCCTATCTGGCCAAAATGGG - Intergenic
1151481294 17:74371443-74371465 CCACCACACCTGGCCAGGACAGG + Intronic
1151640204 17:75386886-75386908 CCACCGCGCCTGGCCAAGATCGG - Intronic
1151796378 17:76349021-76349043 CCACCACGCCTGGCCAAAAATGG - Intronic
1152831357 17:82498816-82498838 ACACCACTCCCGGCCAAAATAGG - Intergenic
1153106623 18:1535446-1535468 CCACCACACCTGGCTAATTTTGG - Intergenic
1153543901 18:6186327-6186349 CCACCATGCCTGGCCAAAAAGGG + Intronic
1153850187 18:9086640-9086662 CCACCACACCTGGCCTATAAAGG + Intergenic
1154484331 18:14860855-14860877 CCACCACACTTGGCAAATTTTGG + Intergenic
1154999060 18:21669094-21669116 CCACCACACCTGGCTAATTTTGG - Intronic
1155255583 18:23995315-23995337 CCACCACACCTGGCTAATTTTGG - Intronic
1155281019 18:24240074-24240096 CCACCACACCTGGCTAATTTTGG + Intronic
1155430486 18:25750980-25751002 CCACCACACCCGGCCATAAGTGG + Intergenic
1155629444 18:27874959-27874981 CCACCACACCTGGCCAATTTTGG - Intergenic
1156332125 18:36132171-36132193 CCACCACACCTGGCCTCGATTGG + Intronic
1157263952 18:46200591-46200613 CCACCGCACCTGGCCAGGATGGG + Intronic
1157346624 18:46842071-46842093 CCACCACACCTGGCTAATTTTGG - Intronic
1157887756 18:51384966-51384988 CCACTGCACTTGGCCAATTTTGG + Intergenic
1158380454 18:56924456-56924478 CCAGCATACGTGGCCAAATTGGG + Intronic
1158580428 18:58676240-58676262 CTACCACGCCTGGCCACAATAGG - Intronic
1158849956 18:61485784-61485806 CCACCGCACCTGGCCAAAATGGG - Intronic
1158956785 18:62547806-62547828 CCAGCACATTTGGCCAAGGTGGG - Intronic
1159206578 18:65261291-65261313 CCACCACCCTTGGCTAATTTTGG + Intergenic
1160166491 18:76517384-76517406 CCACCGCAACCGGCCAAAATTGG + Intergenic
1160223423 18:76993263-76993285 CCACCACACCCAGCCAAAATGGG - Intronic
1160444859 18:78919358-78919380 CCACCACACCTGGCTAATTTGGG + Intergenic
1160471485 18:79138791-79138813 CCACCACACCCGGCCAATACTGG - Intronic
1160574020 18:79838696-79838718 CCACCTCACCTGGCCCAAAGAGG + Intergenic
1160628481 18:80229223-80229245 CCACCACAATTGGCCAGAAGTGG + Intronic
1160741356 19:687557-687579 CCACCACACCTGGCTAATTTTGG + Intronic
1160917124 19:1502353-1502375 CCACCACAGCTGGCCTAAAGGGG + Intergenic
1161460846 19:4396571-4396593 CCACCACACCTGGCCAAACTAGG + Intronic
1161858350 19:6778753-6778775 CCACCACACCCAGGCAAAATTGG - Intronic
1161911176 19:7195353-7195375 CCACCACACCTGGCCAACATTGG - Intronic
1162397579 19:10426050-10426072 CCACCTCGCCTGGCCAAAAGTGG - Intronic
1162412099 19:10512556-10512578 CCATCACACTTGGCTAATTTTGG + Intergenic
1162598828 19:11651123-11651145 CCACCACATCTGGCCACTATGGG - Intergenic
1162645881 19:12049935-12049957 CCACCGCACCCGGCCAAAATTGG - Intronic
1162878494 19:13638770-13638792 CCACCACACCAGGCCGAAATGGG - Intergenic
1163260441 19:16186418-16186440 CCACCACACCTGGCTAATTTTGG + Intronic
1163280992 19:16317655-16317677 CCACCACACCTGGCCACTGTTGG - Intergenic
1163497775 19:17656562-17656584 CCACCGCACCTGGCCAAAAGCGG - Intronic
1163763340 19:19148862-19148884 CCACCACACCTGGCTAATTTGGG + Intronic
1163885865 19:19964276-19964298 CCTCCACATTTGGCCTCAATTGG - Intergenic
1163908779 19:20170182-20170204 CCACCGCGCCCGGCCAAAATGGG + Intronic
1163953776 19:20615081-20615103 CCACCACAGTCGGCTAAAACCGG + Intronic
1164131302 19:22364543-22364565 CCACCACGCCTGGCCTAATTTGG + Intergenic
1164515813 19:28934297-28934319 CCACCACGCCTGGCCCAATTTGG - Intergenic
1164843877 19:31415625-31415647 TGACTACACTTTGCCAAAATGGG + Intergenic
1164873711 19:31668191-31668213 CCACCACGCCCGGCCAAACTTGG - Intergenic
1164874277 19:31672337-31672359 CCACCACGCTTGGCCTCAAAGGG - Intergenic
1164991787 19:32689917-32689939 CCACCACACCTGGCAGAAACTGG - Intergenic
1165005663 19:32804404-32804426 CCACTGCACCTGGCCAAGATAGG - Intronic
1165044635 19:33095009-33095031 CCACCACACCTGGCTAATTTTGG - Intronic
1165370133 19:35400090-35400112 CTACTACACCTGGCCAACATAGG + Intergenic
1165426862 19:35750673-35750695 CCACCGCACCCAGCCAAAATTGG - Intronic
1165488553 19:36110181-36110203 CCACCGCACCTGGCCCAAAGGGG - Intergenic
1165534816 19:36434880-36434902 CCACCACACCTGGCTAATTTTGG - Intergenic
1165650145 19:37480663-37480685 CCACCACACCTAGCCAAAAGTGG - Intronic
1165762869 19:38332505-38332527 CCACCACACCTGGCCACAATAGG + Intergenic
1165786850 19:38466786-38466808 CCACTGCACCTGGCCCAAATGGG + Intronic
1165802194 19:38559519-38559541 CCACCACACCTGGCCAGAGGTGG + Intronic
1165839611 19:38780196-38780218 CCACCACACCCGGCCATAGTTGG - Intergenic
1165882757 19:39055150-39055172 CCACCACACCTGGCTAATTTTGG - Intergenic
1165930324 19:39353887-39353909 CCACCACACCTGGCCAGATTAGG + Intronic
1166211961 19:41312370-41312392 CCACCACACTTGGCCCATTCAGG + Intronic
1166223758 19:41382334-41382356 CCACCACACCTGGCCAGAGATGG - Intronic
1166285699 19:41826403-41826425 CCACCACACCCGGCCAGATTTGG + Intergenic
1166522184 19:43487864-43487886 CCACCACACCTGGCCCACAGTGG - Intronic
1166534405 19:43563197-43563219 CCACCACACCTGGCCCAGACTGG - Intronic
1166534691 19:43565248-43565270 CCACCACACTTGGCTAAGCATGG + Intronic
1166729179 19:45048831-45048853 CCACCACGCTTGGCTAATTTTGG - Intronic
1166805105 19:45481733-45481755 CCACTACACCTGGCCAATAAAGG + Intergenic
1166971327 19:46570290-46570312 CCACCATGCCTGGCCACAATGGG + Intronic
1167003662 19:46761121-46761143 TCACCATACTTGGCCAATACTGG - Intronic
1167087200 19:47318579-47318601 CCACCACACCTGGCCTGAAATGG + Intronic
1167141617 19:47655236-47655258 CCACCACGCCTGGCCAAACTGGG - Intronic
1167301894 19:48682691-48682713 CCACCACACCTGGCCAGCTTCGG - Intergenic
1168547608 19:57266563-57266585 CTACCACACCTGGCCATATTTGG - Intergenic
1168716299 19:58529910-58529932 CCACCACACCCAGCCATAATGGG - Intronic
925678929 2:6396408-6396430 CCACCGCACTAGGCCAAGACTGG + Intergenic
926559414 2:14399836-14399858 CCACCACACCTGGCCTAATTGGG + Intergenic
926727363 2:16008979-16009001 CCACCTCACTTCCCCAACATAGG - Intergenic
927411068 2:22826948-22826970 CCAGCACAGTTGGCCAGAGTTGG + Intergenic
927559884 2:24062599-24062621 CCACCACGGTTGGCCACAATAGG + Intronic
927570624 2:24156343-24156365 CCACCACGCCTGGCCAGAAGGGG - Intronic
927611036 2:24540744-24540766 CCACCGCACCTGGCCAGAACTGG + Intronic
927699863 2:25261149-25261171 CCACCACACTTGGCCACCTCTGG - Intronic
927771381 2:25865141-25865163 CCACCATGCCTGGCCTAAATTGG - Intronic
927807696 2:26162433-26162455 CTGGCACACTTGGCCAAAAATGG - Intergenic
927818475 2:26242052-26242074 CCACCACACCTGGCCAATTCTGG + Intronic
927913717 2:26920476-26920498 CCACCACGCCTGGCCAACAATGG - Intronic
928080414 2:28307292-28307314 CCACCACACCTGGCCTTAATTGG + Intronic
928517902 2:32061638-32061660 CCACCACACCCGGCCGAAAGAGG + Intergenic
928581317 2:32710580-32710602 CCACCACACCTGGCTAATTTTGG + Intronic
928587769 2:32778934-32778956 CCACCACACCCGGCCTAAAATGG - Intronic
928641307 2:33302773-33302795 CCACCACATCTGGCCTCAATAGG - Intronic
928938446 2:36704211-36704233 CCACCACTCCTGGCCAGATTGGG + Intronic
928963512 2:36954221-36954243 CCACCACGCCTGGCCAAATTTGG - Intronic
929314775 2:40464180-40464202 CCACCACACCTGGCCAAAAGAGG + Intronic
929464698 2:42133984-42134006 CCACCGCGCCTGGCCACAATAGG - Intergenic
929596088 2:43177041-43177063 CCACCACGCCTGGCCAAACAAGG + Intergenic
930110101 2:47671579-47671601 CCACCATGCCTGGCCAATATAGG + Intergenic
930124895 2:47787893-47787915 CCACCACACCTGGCCTATTTTGG + Intronic
930377565 2:50587195-50587217 CCACCATGCCTGGCCAAAACAGG - Intronic
930377809 2:50589639-50589661 CCACCATGCCTGGCCAAAACAGG + Intronic
930789226 2:55306727-55306749 CCACCACACTGGGCTAATTTTGG + Intronic
931381762 2:61760618-61760640 CCACCACGTCTGGCCAAAAAGGG + Intergenic
932156298 2:69421049-69421071 CCACCTCACCTGGCTAAATTCGG - Intronic
932347180 2:71003329-71003351 CCACCACACCCAGCCAAAATAGG + Intergenic
932347512 2:71005268-71005290 CCACCAGACACAGCCAAAATAGG + Intergenic
932458673 2:71866945-71866967 TGACTACACTTGTCCAAAATTGG - Intergenic
933177337 2:79190478-79190500 TCACCATACTTGGACACAATAGG + Intronic
933429421 2:82156477-82156499 CCACCACGCCTGGCCAAGAATGG + Intergenic
933901313 2:86852252-86852274 CCACCACATCTGGCCAAAACTGG + Intronic
934175110 2:89572035-89572057 CCACCGCACCTGGCCAAGAAAGG - Intergenic
934285426 2:91646389-91646411 CCACCGCACCTGGCCAAGAAAGG - Intergenic
934926348 2:98384209-98384231 CCCCCAAAATTGGCCCAAATTGG - Intronic
935219946 2:101003431-101003453 CCACCACACCTGGCCCACCTTGG + Intronic
935230158 2:101089059-101089081 CCACCACGCCTGGCCAACATTGG - Intronic
935301782 2:101698632-101698654 CCACGCCGCTTGGCCAAAGTTGG + Intronic
935617480 2:105101459-105101481 CCACCACACCTGGCTTAAAATGG - Intergenic
935779236 2:106496985-106497007 CCACCACGTCTGGCCAAAACTGG - Intergenic
936347159 2:111683828-111683850 CCACCGCACCTGGCTAAGATCGG - Intergenic
936401282 2:112166336-112166358 CCACCACACCTGGCCAAGAGAGG + Intronic
936660400 2:114536690-114536712 CCACCATGCTTGGCCAACTTTGG + Intronic
938010410 2:127824389-127824411 CCACCACACCTGGCCAACAGTGG + Intergenic
938035810 2:128034070-128034092 CCACCATGCCTGGCCAAGATTGG - Intergenic
939348478 2:141000204-141000226 CCACCACACTTGGCCAGACAGGG + Intronic
939518948 2:143204973-143204995 CCACCACACCTGGCCACTATGGG - Intronic
940377833 2:152976609-152976631 CCACCACGCCTGGCCGAAAATGG + Intergenic
940486331 2:154300388-154300410 CCACCGCACCTGGCCAGAAATGG + Intronic
940886060 2:158990221-158990243 CCACAGCACCCGGCCAAAATGGG + Intronic
940921502 2:159312759-159312781 CCACTGCACCTGGCCAAAAAAGG + Intergenic
940931406 2:159436459-159436481 CCACCACACCTGGCCCCAAATGG - Intronic
941551775 2:166925774-166925796 CCACCACACTCTGCCAAAAAAGG - Intronic
941680460 2:168393047-168393069 CCACCACGCTTGGCCTGACTTGG - Intergenic
941695105 2:168542847-168542869 CCACCACACCTGGCTAATTTTGG + Intronic
941915614 2:170811673-170811695 CCACCACTGTTGGCCAGACTGGG + Intergenic
941996745 2:171608449-171608471 CCACCACACCCAGCCAAAACTGG - Intergenic
942055180 2:172175329-172175351 CCGCCACACTTGGCCCATATTGG + Intergenic
942135755 2:172923553-172923575 CCACCACACCTGGCCAGACTTGG + Intronic
942217131 2:173732454-173732476 CCACCACACCTGGCTAATTTTGG + Intergenic
942235993 2:173905709-173905731 CCACCACGCTTGGCCAAATCTGG - Intergenic
942724979 2:178996363-178996385 CCACCGCACCTGGCCAAAATTGG + Intronic
943050594 2:182908611-182908633 CCACTGCACCCGGCCAAAATGGG + Intergenic
943637647 2:190323955-190323977 TCACCGCACCTGGCCAAATTGGG + Intronic
944156087 2:196609217-196609239 CCACTGCACCTGGCCAAAACTGG - Intergenic
944267042 2:197739610-197739632 CCACCACAGTTGGCCAGAATTGG + Intronic
944497920 2:200327249-200327271 CCACCACACTGGGCTAATTTTGG - Intronic
944753963 2:202740205-202740227 CCACCACACTCGGCTAATTTGGG - Intronic
945061196 2:205910444-205910466 CCACAGCACATGTCCAAAATGGG - Intergenic
945124537 2:206493657-206493679 CCACCACACCTAGCCTATATTGG + Intronic
945172729 2:207013468-207013490 CCACCTCACCTGGCCAAAACTGG + Intergenic
945291795 2:208134360-208134382 CCACCACACCCAGCCATAATGGG + Intergenic
946283162 2:218681277-218681299 CCACCACACGTGGCTAATTTTGG + Intronic
946726271 2:222664586-222664608 CCACCGCACCCGGCCTAAATTGG + Intergenic
946839531 2:223806569-223806591 CCACCGCACCTGGCCAACAAAGG + Intronic
946945351 2:224815881-224815903 CCACCACACCTGGCTAATTTTGG - Intronic
947692128 2:232148332-232148354 CCACCGCACCCGGCCAAGATAGG + Intronic
947753892 2:232547117-232547139 CCACCACACCTGGCCAGGAATGG - Intergenic
947766511 2:232641318-232641340 CCACCGCACCTGGCCACAATCGG + Intronic
947857337 2:233333081-233333103 CCACCGCACCTGGCCTATATGGG + Intronic
947931570 2:233969189-233969211 CCACCATGCCTGGCCAAACTTGG - Intronic
948022780 2:234750059-234750081 CCACCACACCTGGCCAATTTTGG - Intergenic
948139607 2:235662657-235662679 CCACCACACCTGGCCGAAGTTGG + Intronic
1168814970 20:730032-730054 CCACCACACTCAGCCAATAGAGG + Intergenic
1169349631 20:4857641-4857663 CCACCACACCTGGCCTAGAGAGG - Intronic
1169383723 20:5129864-5129886 CCACCACACCTGGCCATGTTTGG + Intronic
1169452139 20:5721187-5721209 CCACCACGCCTGGCCTAAAAAGG - Intergenic
1169747504 20:8957670-8957692 CCACCACACTCGGCTAATTTTGG + Intronic
1170597731 20:17818234-17818256 CCACCACACCTGGCTAATAGTGG + Intergenic
1171123926 20:22585922-22585944 CCAGCCCACCTGTCCAAAATTGG + Intergenic
1171390628 20:24799456-24799478 CCTCCACCCTTGGCCAGCATGGG + Intergenic
1171796304 20:29569146-29569168 CCACCACACCTGGCTAACACCGG + Intergenic
1171899409 20:30843287-30843309 CCACCACACCTGGCAAGACTGGG - Intergenic
1172160142 20:32862281-32862303 CCACCACACCTGGCTAATTTTGG + Intronic
1172215438 20:33232511-33232533 CCACCACACCCGGCCAGAAATGG + Intergenic
1172542080 20:35726416-35726438 CCACCACGCCTGGCCCAAAAAGG + Intronic
1172641798 20:36444791-36444813 CCACCACGCTCGGCCAATTTTGG + Intronic
1172726522 20:37047690-37047712 CCACCACACTCAGCCAATCTAGG - Intronic
1172740912 20:37166256-37166278 TCACCAAACTTGGCAACAATGGG - Intronic
1172826900 20:37796506-37796528 CTTCCACTCTGGGCCAAAATGGG - Intronic
1174324271 20:49766798-49766820 CCACCACACCTGGCTAATACTGG + Intergenic
1174583974 20:51593122-51593144 CCACCACACCTGGCTAATTTTGG - Intergenic
1174591771 20:51651639-51651661 CCACCACTCCTGGCCAAAAAAGG - Intronic
1174659539 20:52199588-52199610 CCACCACACTTGGCCAAAATAGG - Intronic
1175148521 20:56914546-56914568 CCACCACACTTGGCTCATAAGGG + Intergenic
1175878288 20:62241343-62241365 CCACCACACCTGGCTAATTTTGG + Intronic
1176155111 20:63615611-63615633 CCACCAGGCCTGGCCAACATAGG + Intronic
1176190485 20:63807067-63807089 CCACCACGCCTGGCCAGGATTGG + Intronic
1176723072 21:10408186-10408208 CCACCACACCTGGCAAATTTTGG + Intergenic
1176796999 21:13378614-13378636 CCACCACACCTGGCAAATTTTGG - Intergenic
1177383095 21:20371015-20371037 CCACCACACCTGGCAAATTTTGG - Intergenic
1177589448 21:23143915-23143937 CCACCACACCCAGCCAAAAAAGG + Intergenic
1177856716 21:26407857-26407879 CAACCATGCCTGGCCAAAATAGG - Intergenic
1177931209 21:27286092-27286114 CCATCACACCTGGCCAAACTTGG + Intergenic
1178099879 21:29256188-29256210 CCCACACACTTGGCTGAAATTGG + Intronic
1178402784 21:32301247-32301269 CCACCACGCCTGGCCCAATTAGG + Intronic
1178789156 21:35682622-35682644 CCACCGCGCCTGGCCTAAATTGG + Intronic
1178800670 21:35792311-35792333 CCACCACAGATGGCCAGATTGGG + Intronic
1179154224 21:38835940-38835962 CCACCACACCTGGCCCAGCTAGG - Intergenic
1179323161 21:40312823-40312845 CCACCACATCCAGCCAAAATTGG - Intronic
1180048544 21:45320906-45320928 CCACCCCACGTGGCCACACTGGG + Intergenic
1180221414 21:46360803-46360825 CCACCACGCCTGGCCATAGTTGG + Intronic
1180304232 22:11060922-11060944 CCACCACACCTGGCAAATTTTGG + Intergenic
1180321832 22:11329119-11329141 CCACCACACCTGGCAAGACTGGG + Intergenic
1180333223 22:11551565-11551587 CCACCACACCTGGCAAGACTGGG - Intergenic
1180889014 22:19271817-19271839 CCACCTCAATTGGCCAAGAATGG - Intronic
1181147088 22:20856585-20856607 CCACCACACCTGGCTAATGTTGG + Intronic
1181148381 22:20865065-20865087 CCACCACACCTGGCCATCAATGG - Intronic
1181293391 22:21815616-21815638 CCACCACACCTGGCCAATAAAGG + Intronic
1181470943 22:23139331-23139353 CCACCATACCTGGCCAAAGCTGG - Intronic
1181767069 22:25099798-25099820 CCACCGCACCTGGCCAAATATGG + Intronic
1181797810 22:25322450-25322472 CCACCAGACTCGGCCTATATTGG - Intergenic
1181889880 22:26053092-26053114 CCACCACACCCGGCCGAATTGGG + Intergenic
1182049488 22:27301935-27301957 CCACCACGCCTGGCCAATATCGG + Intergenic
1182722825 22:32417458-32417480 CCACCACACCTGGCCAATCATGG + Intronic
1182955374 22:34419399-34419421 CCACCACACCTGGCTAATTTTGG + Intergenic
1183229626 22:36573617-36573639 CCACCACACATGGCCTATATAGG + Intronic
1183250199 22:36725084-36725106 CCACCACACCTGGCCAAGAGGGG - Intergenic
1183295708 22:37028243-37028265 CCACCACGCCTGGCCTAATTTGG - Intronic
1183682866 22:39344147-39344169 CCCCCACACTTGGCCATGTTTGG - Intergenic
1183696064 22:39423123-39423145 CCACCACACCTGGCTAATTTTGG + Intronic
1184056440 22:42053743-42053765 CCACCACACCTGGCCAATGTTGG + Intronic
1184755270 22:46512281-46512303 CCACCGCACCTGGCCAGTATTGG - Intronic
1185040738 22:48502810-48502832 CCACCGCACCTGGCCAAGAGTGG + Intronic
949424643 3:3903785-3903807 CCACCACACCTGGCCTAAAAAGG + Intronic
949979905 3:9495787-9495809 CCACTGCACCTGGCCAAACTGGG - Intergenic
950284208 3:11732152-11732174 CCACCACACTTGGCCCATTAGGG + Intergenic
951215373 3:20019574-20019596 CCACCGCGCCTGGCCTAAATTGG - Intergenic
951586476 3:24220201-24220223 CCACCACACCTGGCCACTCTAGG - Intronic
951826305 3:26873039-26873061 CTCCCACAGTTGACCAAAATGGG - Intergenic
952320683 3:32275155-32275177 CCACCACACCTGGCTAACTTGGG + Intronic
952371395 3:32726405-32726427 CCACCGCCCCTGGCCTAAATAGG - Intronic
953444634 3:42952662-42952684 CCACCACACCTGGCCAACAATGG - Intronic
953476346 3:43209027-43209049 CTACCGCACCTGGCCAAAATGGG - Intergenic
953949334 3:47176439-47176461 CCACCACACCTGGCTAACTTCGG - Intergenic
954042903 3:47903244-47903266 CCACCGCACCTGGCCAGAAAAGG - Intronic
954207245 3:49068916-49068938 CAACCACACCCGGCCAAACTTGG + Intronic
954225860 3:49180641-49180663 CCACCGCACCTGGCCTAAAAAGG - Intronic
954485534 3:50847594-50847616 CCACTGCACTTGGCCATAGTGGG - Intronic
954724682 3:52597676-52597698 CCACCACACGAGGCTAAGATGGG - Intronic
954778296 3:53039785-53039807 CCACCACACCTGGCTAATTTTGG + Intronic
954816876 3:53289321-53289343 CCACCACTCCCGGCCATAATTGG - Intronic
955137142 3:56230545-56230567 CCGCCACAGTTGGCCTAAAGTGG + Intronic
955171315 3:56567975-56567997 CCACCACGCCCGGCCAAAAGTGG + Intronic
955247811 3:57244441-57244463 CCACCACACATGGCCAGCAAAGG + Intronic
955559738 3:60176063-60176085 CCACCACACCTGGCCACATGTGG - Intronic
955750694 3:62183409-62183431 CCACCACACCTGGCCAATTTTGG - Intronic
956787769 3:72656420-72656442 CCACCACACCTGGCTTAACTGGG + Intergenic
956911256 3:73820148-73820170 CCACCACACCTGGCCTAAAATGG + Intergenic
957295579 3:78328838-78328860 CCACTGCACTTGGCCACAAAGGG + Intergenic
957510729 3:81184603-81184625 ACACCACACCTGGCCAAATGTGG + Intergenic
957781584 3:84824275-84824297 CCACCGCACCCGGCCAAATTTGG + Intergenic
957782591 3:84838427-84838449 CCACCACACCTGGCTAATTTTGG + Intergenic
957839767 3:85653058-85653080 CCACCGCACCTGGCCTAACTTGG + Intronic
958020165 3:87984743-87984765 CCACCACACCCAGCCAAAAGAGG + Intergenic
958530455 3:95323504-95323526 CCACCACACTTGGCCCAGTATGG - Intergenic
958963925 3:100537208-100537230 CCACCATGCCTGGCCAGAATAGG + Intronic
959072991 3:101720501-101720523 CCACCACACCTGGCTAATTTTGG - Intergenic
959318952 3:104847122-104847144 CCACAACACATGGGAAAAATCGG - Intergenic
959687687 3:109165512-109165534 CCACCACACCAAGCCAAAACCGG - Intergenic
960031526 3:113059261-113059283 CCACCACGTCTGGCCAAAAGAGG - Intergenic
960081201 3:113542208-113542230 CCACCACACTTGGCATTAGTAGG + Intronic
960112652 3:113860305-113860327 CCACTGCACTCGGCCAAAATGGG + Intronic
960119857 3:113936849-113936871 CCACCACACCTGGCTAAAATTGG + Intronic
960666911 3:120118314-120118336 CCACCATGCCTGGCCAAAAAGGG - Intergenic
960729098 3:120704756-120704778 CCACCATACCTGGCCATAAATGG - Intronic
960729885 3:120715249-120715271 CCACCACACCTGGCCTGTATTGG - Intronic
960813553 3:121649520-121649542 CCACCACGCCTGGCCTAAACAGG + Intronic
960966313 3:123107322-123107344 CCTCCACCCCTGGCCAAATTTGG - Intronic
961031138 3:123605026-123605048 CCACCACGCCCGGCCAAAATGGG - Intergenic
961223097 3:125215441-125215463 CCATCACACCTGGCTAAATTTGG - Intergenic
961242472 3:125423910-125423932 CCACCACACCTGGCTAATGTTGG + Intergenic
961715672 3:128855870-128855892 CCACCACAGTTGGCTGAAACTGG - Intergenic
961844979 3:129754923-129754945 CCACCACACCTGGCTAATTTTGG - Intronic
961848354 3:129788753-129788775 CCACCACACCTGGCCTTACTGGG + Intronic
961899657 3:130198236-130198258 CCACCACACGTGGCTAATTTTGG - Intergenic
962086095 3:132193474-132193496 TCACCACACTTGGCCACTAAAGG - Intronic
962246180 3:133795861-133795883 CCACTGCACCTGGCCAAAAAGGG + Intronic
962923809 3:139973922-139973944 CCACCACTCCTGGCCAGAAATGG + Intronic
963145066 3:141985239-141985261 CCACTGTGCTTGGCCAAAATAGG - Intronic
963157314 3:142112806-142112828 CCACCACACCCAGCCAAAACTGG + Intronic
963194470 3:142511366-142511388 CCACCACACCTGGCCAAAATGGG - Intronic
963201736 3:142593110-142593132 CCACCACACCTGGCTAATTTTGG + Intergenic
963210164 3:142680350-142680372 CCACCATGCCTGGCCAAAACTGG + Intronic
963808812 3:149754329-149754351 CCACCATACCTGGCCTAACTTGG - Intergenic
964752754 3:160067589-160067611 CCACCACACCTGGCCTAGCTTGG - Intergenic
964868622 3:161289208-161289230 CCACCACACTTGGCTACTTTGGG + Intergenic
965042927 3:163534180-163534202 CCACCACACCTGGCCAATCGTGG - Intergenic
965583941 3:170298556-170298578 CCACCACACCTGGCTAATTTCGG + Intronic
966172731 3:177100575-177100597 CCACCACGCCTGGCCAATTTTGG + Intronic
966328645 3:178786255-178786277 CCACCACAATTGGATAGAATAGG + Intronic
966533723 3:181008249-181008271 ACACCACACTTGGCCCTTATTGG + Intergenic
966542604 3:181108494-181108516 CCACTACACTCAGCCAAAAGGGG - Intergenic
966823292 3:183942190-183942212 CCACCACACCTGGCTAATTTTGG + Intronic
966829495 3:183994659-183994681 CCACCGCACCTGGCCAGTATTGG + Intronic
967019115 3:185507083-185507105 CCACCACACCCGGCCAAAAATGG - Exonic
967869935 3:194221530-194221552 CCAGCTCCCTTGGCCAAGATCGG - Intergenic
968214395 3:196876008-196876030 CCACCATGCCTGGCCAATATTGG + Intronic
968761875 4:2446675-2446697 CCACCACACCTGGCCATTATTGG + Intronic
969010320 4:4056391-4056413 CCACCACACCTGGCTAATTTTGG - Intergenic
969559301 4:7936866-7936888 CCACCACACCTGGCCACAAGTGG + Intronic
969633027 4:8349493-8349515 CCACCACGCCTGGCCAAGACAGG - Intergenic
969743731 4:9053502-9053524 CCACCACACCTGGCTAATTTTGG + Intergenic
969963891 4:10974728-10974750 CCACGACACCTGGGGAAAATGGG + Intergenic
970766015 4:19550006-19550028 CCACCACACCCGGCCAGAATTGG - Intergenic
971345524 4:25808780-25808802 CCACTGCACATGGCCCAAATAGG - Intronic
971944008 4:33251126-33251148 CCGCCACACCCGGCCGAAATAGG - Intergenic
972026252 4:34382272-34382294 CCACCACGCCTGGCCAATTTAGG - Intergenic
972525699 4:39908734-39908756 CCATCACACCTGGCCAACTTGGG - Intronic
972549442 4:40115207-40115229 CCACCACACCTGGCATACATAGG - Intronic
972641524 4:40929585-40929607 CCACCGCACTGGGCCAATAAGGG + Intronic
972652730 4:41034610-41034632 TCACGACACCTGGCCAAAAAGGG + Intronic
972674173 4:41243310-41243332 CCACCACACCTGGCCTACTTAGG + Intergenic
972790553 4:42367657-42367679 CCACCACACCTGGCCCACACTGG - Intergenic
972922840 4:43965502-43965524 CCACCACGCCTGGCCGAAAATGG - Intergenic
973337544 4:48971826-48971848 TCACCACACCTGGCCAATATTGG - Intergenic
974001921 4:56520288-56520310 CCACCGCACCTGGCTACAATGGG + Intronic
974006941 4:56567417-56567439 CCACCACACCTGGCTAATTTTGG + Intronic
974008923 4:56589139-56589161 CCACCACACCTGGCTAATTTTGG + Intronic
974051017 4:56942244-56942266 CCACCACACCTGGCTAATTTTGG - Intergenic
974264294 4:59564193-59564215 CCACCACACCTGGCTAATGTTGG - Intergenic
974435049 4:61846025-61846047 CCACCATACCTGGCCAAGAAAGG - Intronic
974443756 4:61952324-61952346 CCACCACACCTGGCTAATTTTGG - Intronic
974892506 4:67898782-67898804 CCACCACACCTGGCTAATTTTGG - Intergenic
974976571 4:68901337-68901359 CCACCACAGTTGGCTGAAACCGG - Intergenic
975236522 4:72003590-72003612 CAAAAACACTTGACCAAAATAGG - Intergenic
976206415 4:82627033-82627055 CCACCACACCTGGCCAAAAATGG + Intergenic
976607614 4:86997197-86997219 CCACCACGCTTGGCCTGAACTGG + Intronic
976652411 4:87450150-87450172 CCACCACACCTGGCCTGAAGTGG + Intronic
977174461 4:93803434-93803456 CCACCGCACCCGGCCAAAAAAGG - Intergenic
977207270 4:94177386-94177408 CCACCACCCCTTGCCAAAATGGG + Intergenic
977412809 4:96689768-96689790 CCACCACGCCTGGCCAAATGTGG - Intergenic
977541984 4:98329500-98329522 CCACCACACCTTGCCCTAATGGG - Intronic
977939405 4:102842820-102842842 CCACCACGCCTGGCCAAAACTGG - Intronic
978785551 4:112605446-112605468 TCACCATGCCTGGCCAAAATAGG + Intronic
978802866 4:112771870-112771892 CCACCGCACCTGGCCTAAACTGG + Intergenic
979034557 4:115698348-115698370 CCACCACACTCAGCCCTAATGGG - Intergenic
979316110 4:119265516-119265538 CCACCACACCTGGCTAATTTTGG - Intronic
979320408 4:119316649-119316671 CCACCCTGCTTGGCCAAAAGAGG - Intergenic
980058748 4:128105603-128105625 ACACCACGCCTGGCCATAATTGG - Intronic
980936005 4:139226567-139226589 CCACTGCACCTGGCCAAAATTGG - Intergenic
981693139 4:147531717-147531739 CCACCACACCCGGCCACAAGTGG - Intronic
981982352 4:150809565-150809587 CCACTGCACCTGGCCAAAAATGG - Intronic
981986765 4:150866001-150866023 CCACCACACCTGGCCAGAAATGG + Intronic
982003278 4:151040735-151040757 CCACCACACTTGGCTTATTTTGG - Intergenic
982030909 4:151299912-151299934 CCACCACACCCGGCCGACATTGG - Intronic
982349736 4:154401703-154401725 CTACCACACCTGGCCACCATTGG - Intronic
982598854 4:157419740-157419762 GGACCACACTTTGTCAAAATAGG - Intergenic
983739164 4:171106199-171106221 CCACCATGCCTGGCCAACATAGG + Intergenic
984582089 4:181521807-181521829 CCACCACACCCGGCCCACATTGG - Intergenic
984734046 4:183094252-183094274 CCACCACGCTTGGCCAGCAGTGG + Intergenic
984794260 4:183643763-183643785 CCACCACACCTGGCTAATTTTGG - Intronic
985162312 4:187057385-187057407 CCACCGCACCCGGCCTAAATGGG + Intergenic
985210251 4:187585283-187585305 CCACCACACCTGGCCAACAAAGG + Intergenic
986243981 5:5988504-5988526 CCACCACGCCCGGCCAAGATAGG + Intergenic
986539990 5:8834921-8834943 CCACCACACCTGGCCTAACATGG - Intergenic
986689029 5:10298603-10298625 CCACCGCACTCAGCCCAAATGGG - Intronic
988042331 5:25905485-25905507 CCACGACACTTGGGGATAATGGG + Intergenic
988786368 5:34569032-34569054 CCACCACACCTGGCCCACACTGG + Intergenic
989055274 5:37360496-37360518 CCACCGCACTTGGCCTTCATTGG - Intronic
989077477 5:37579296-37579318 CCACCGCACCCGGCCAGAATTGG - Intronic
989154060 5:38327083-38327105 CCACCGCACCTGGCCAATAAGGG + Intronic
989594440 5:43142981-43143003 CCACCATACTTGGCCAGACATGG + Intronic
989597749 5:43172331-43172353 CCACTGCACCTGGCCAAATTAGG - Intronic
989641314 5:43585677-43585699 CCACCGCACCCGGCCAAAAGAGG - Intergenic
990392423 5:55338988-55339010 AGACCAGCCTTGGCCAAAATGGG - Intronic
990428293 5:55710766-55710788 CCACCACACCTGGCTAATTTTGG + Intronic
991060759 5:62372947-62372969 CCACCACGCCCGGCCAAAAGAGG - Intronic
991226539 5:64279803-64279825 CCACCACGTCTGGCCAAAAATGG - Intronic
991714109 5:69435464-69435486 CCACCACACCCAGCCAATATAGG - Intronic
991771318 5:70043615-70043637 CCACCACACCTGGCTAATTTTGG - Intergenic
991850610 5:70919032-70919054 CCACCACACCTGGCTAATTTTGG - Intergenic
992415207 5:76546146-76546168 CCAACACACCCGGCCAAAAAGGG - Intronic
992610367 5:78503408-78503430 CCACCGCACCTGGCCAAGACGGG - Intronic
992721738 5:79567693-79567715 CCACCGCACCTGGCCACAAATGG + Intergenic
993631092 5:90286790-90286812 CCACCACACCTGGCTAATTTTGG - Intergenic
993957691 5:94255999-94256021 CCACCACACTTGGCCAATTATGG + Intronic
994168904 5:96638116-96638138 CCACCACACCAGGCCCAAAAGGG - Intronic
995166181 5:109044466-109044488 CCACCACGCCTGGCCAAATGAGG + Intronic
995990425 5:118231718-118231740 CCACCACACTCGGCCAGAGAAGG + Intergenic
996079873 5:119245827-119245849 CCACCGCACCTGGCCTAGATTGG + Intronic
996508255 5:124291183-124291205 CCACCACACTTGGCCCAGTTAGG + Intergenic
996554554 5:124764309-124764331 CCACCGCGCCTGGCCAATATGGG + Intergenic
996624762 5:125557356-125557378 CCACCGCACTTGGCCAGAAACGG - Intergenic
997131322 5:131279070-131279092 CCACCACACCTGGTGAATATTGG + Intronic
997140560 5:131375949-131375971 CCACCATGCCTGGCCAAGATGGG - Intronic
997181221 5:131831260-131831282 CCACCATGCCTGGCCAAAAGAGG - Intronic
997212268 5:132084108-132084130 CCACTGCACCTGGCCAGAATAGG - Intergenic
997451462 5:133987069-133987091 CCACCACACCTGGCCTCAAATGG - Intronic
997574251 5:134961569-134961591 CCACCGCGCTTGGCCAGAAGTGG + Intronic
997898810 5:137744440-137744462 CCACCACACCTGGCCTAAAATGG - Intergenic
998099064 5:139416899-139416921 CCACCACACCCGGCCAATCTGGG - Intronic
998238633 5:140422410-140422432 CCACCACACCTGGCCTAGAGTGG + Intronic
998359415 5:141572512-141572534 CCACCACACCTGGCCTACATAGG - Intronic
998844744 5:146297394-146297416 CCACCACGCTCGGCCAAGAAAGG - Intronic
999460597 5:151754695-151754717 CCACCACACCTGGCCCGATTTGG - Intronic
1001874653 5:175189083-175189105 CCACCATGCTTGGCCTAGATTGG + Intergenic
1002213843 5:177614098-177614120 CCACCACACCTGGCCTATGTTGG + Intergenic
1002623717 5:180509282-180509304 CCACCACACTTGGTTAATTTTGG + Intronic
1002723039 5:181276292-181276314 CCACCACACCTGGCAAATTTTGG + Intergenic
1003091417 6:3106961-3106983 CCACCACACCTGGCCAACCATGG - Intronic
1003200602 6:3956753-3956775 CCACTACACCTGACCCAAATGGG + Intergenic
1003421861 6:5965581-5965603 CCACCACGCTTGGCCATGACTGG + Intergenic
1003564568 6:7212224-7212246 GCAGGACACTTGGCCAAAAATGG + Intronic
1003916821 6:10794703-10794725 CCACCGCACCTGGCCAGAATAGG - Intronic
1003928813 6:10903259-10903281 CCACCACGCCTGGCCGAGATGGG - Intronic
1003943551 6:11052092-11052114 CCACCACACCTGGCCAAGATGGG + Intergenic
1004305617 6:14499418-14499440 CCACCACACCTGGCCCACTTAGG + Intergenic
1004331075 6:14721866-14721888 CCACCACACCTGACAAATATTGG - Intergenic
1004331370 6:14724992-14725014 CCACCAAGCTTGGCTGAAATTGG - Intergenic
1004503327 6:16227871-16227893 CCACCACAGTTGGCTGAAACTGG - Intergenic
1004887138 6:20062045-20062067 CCACCACACCCGGCCACAAGAGG + Intergenic
1005050039 6:21676136-21676158 CCACCACACCTGGCCACACCTGG + Intergenic
1005281803 6:24282528-24282550 CCACCACACCTGGCCAAGATTGG + Intronic
1005292227 6:24390999-24391021 CCACCACACTTGGCTAATTTTGG - Intergenic
1005319194 6:24635389-24635411 CCACCACACCTGGCCAGGAAAGG + Intronic
1005333119 6:24768088-24768110 CCACCACGCCTGGCCCAAAATGG - Intergenic
1005638045 6:27769754-27769776 CCACCGCGCCTGGCCAAAAATGG - Intergenic
1005728307 6:28671135-28671157 CCACTGCACGTGGCCAGAATAGG + Intergenic
1006037788 6:31227430-31227452 CCATCACAGTCGGCTAAAATCGG - Intergenic
1006129082 6:31858148-31858170 CCACCACGCTTGGCCAAGTGTGG + Intronic
1006216351 6:32446641-32446663 CCACCGCGCCTGGCCAAAAACGG - Intergenic
1006413013 6:33886216-33886238 CCACCACACCTGGCTAATTTTGG - Intergenic
1006427867 6:33977417-33977439 CCACCACACCTGGCCAGGACAGG + Intergenic
1006524372 6:34591201-34591223 CCACCACACTTGGCCTAACCAGG - Intronic
1006780450 6:36628859-36628881 CCACCACACCTGGCTAATTTTGG - Intergenic
1006840069 6:37022778-37022800 CCAGCAGATTTGGCCAAGATGGG - Intronic
1006947359 6:37793651-37793673 CCACCACACCCAGCCAAATTTGG - Intergenic
1006957486 6:37886849-37886871 CCACCACACCTGGCTAATTTTGG - Intronic
1007052071 6:38841868-38841890 CCACCACACCTGGCCACATGAGG + Intronic
1007068371 6:39016016-39016038 CCACCTCACTTGGCCAAATCTGG + Intronic
1007145127 6:39621876-39621898 CCACCACGCCTGGCTGAAATAGG - Intronic
1007490001 6:42213159-42213181 CCACCACACCTGGCCAGTACTGG - Intronic
1007591416 6:43023108-43023130 CCACCACACCCGGCCAGGATAGG - Intronic
1007678422 6:43617337-43617359 CCACCACACCTGACCCACATTGG - Intronic
1008483980 6:52015535-52015557 CCACTGCACTCGGCCAAAAGTGG - Intronic
1008721245 6:54356245-54356267 CCACCACACCTGGCCTGATTTGG - Intronic
1008790993 6:55233376-55233398 CCACCACGCATGGCCAAAGCTGG + Intronic
1009607247 6:65887408-65887430 CCACCACACCCGGCCAGAAGTGG + Intergenic
1009617054 6:66023569-66023591 CCACCACACCTGGCCACTAAGGG - Intergenic
1009953095 6:70419131-70419153 CCACCATGCCTGGCCAAAACAGG - Intronic
1009999584 6:70935156-70935178 CCACCACACCTGGCCACGTTTGG - Intronic
1010087459 6:71937538-71937560 CCACCACACCTGGCCAGAGGTGG + Intronic
1011444266 6:87421196-87421218 CCACCACGCTCGGCCTATATTGG - Intronic
1011662565 6:89606880-89606902 CCACTGCACCTGGCCAAAAAAGG - Intronic
1011690385 6:89861695-89861717 CCACCACATCTGGCCAAAGCTGG + Intronic
1011961473 6:93095852-93095874 CCACCGCACCTGGCCGGAATTGG + Intergenic
1012257916 6:97055508-97055530 CCACCACACCTGGCAAGAAAAGG - Intronic
1012667813 6:101998964-101998986 CCACCACACCTGGCTAACTTTGG + Intronic
1013122801 6:107156040-107156062 CCACCACACCTGGCTAATTTTGG + Intronic
1013215540 6:108024130-108024152 CAACCACACTAGGCCCAAGTAGG + Intergenic
1013515408 6:110880823-110880845 CCACCACACCTGGCTAATTTTGG + Intronic
1014735382 6:125088956-125088978 ATCCCACACTTGGCCAAGATGGG - Exonic
1014981649 6:127952555-127952577 CCACCACGCCTGGCCTAAAGTGG - Intergenic
1015617570 6:135093431-135093453 TGACCACACCTGGCCAACATAGG + Intronic
1015726214 6:136302142-136302164 CCACCGCACCTGGCCAGAAAGGG - Intergenic
1016006536 6:139094510-139094532 CCACCATGCTCAGCCAAAATTGG + Intergenic
1016268290 6:142257719-142257741 CCACCACGCCCAGCCAAAATGGG - Intergenic
1016831888 6:148442252-148442274 CCACCACACCTGGCTAATTTTGG - Intronic
1018214318 6:161512320-161512342 GAAACACACTTGGCCAAAAAGGG + Intronic
1018794217 6:167173360-167173382 CCACCACACTTGGCTAATTTTGG - Intronic
1018822102 6:167381669-167381691 CCACCACACTTGGCTAATTTTGG + Intronic
1020795449 7:12673522-12673544 CCAACACACCTGGCCAAAAATGG - Intergenic
1021112665 7:16713412-16713434 CCACCACCTTTGGCCTAAAAAGG - Intergenic
1021289351 7:18823824-18823846 CCACCACACCTGGCTAATTTTGG - Intronic
1021714844 7:23452289-23452311 CCACCGCACCTGGCCAGAATAGG + Intronic
1022952731 7:35353930-35353952 TCACCAAACTAGGCCAAACTGGG - Intergenic
1023392051 7:39720208-39720230 CCACCACTCCTGGCCAAATAGGG + Intergenic
1023814402 7:43938546-43938568 CCACCGCACCTGGCCTAAGTTGG - Intronic
1023905433 7:44518455-44518477 CCACCGCACCTGGCCCAAAAAGG + Intronic
1023943854 7:44787768-44787790 CCACCGCACCTGGCCTAAATAGG - Intergenic
1023986311 7:45099164-45099186 CCACCACACCTGGCCGACTTAGG + Intergenic
1024045933 7:45585732-45585754 CCACCACACCTGGCCCAGGTGGG + Intronic
1024213906 7:47230312-47230334 CCACCACACCTGGCCATGGTTGG - Intergenic
1024497136 7:50061411-50061433 CCACCACACCAGGCCATGATGGG - Intronic
1024559345 7:50630225-50630247 CCACCACCCCAGGCCAAGATAGG - Intronic
1024735467 7:52300184-52300206 CCACTGCACCTGGCCAAATTAGG - Intergenic
1025104528 7:56160299-56160321 CCACCACACCTGGCTAATTTTGG - Intergenic
1025238504 7:57251666-57251688 CCACTGCACTTGGCCACAACTGG + Intergenic
1025834068 7:65079451-65079473 CCACCACACCTGGCCTATAAGGG - Intergenic
1025903839 7:65768968-65768990 CCACCACACCTGGCCTATAAGGG - Intergenic
1025913828 7:65849907-65849929 ACACCACATCTGGCCAAGATTGG - Intergenic
1025975733 7:66368137-66368159 CCACCACATCTGGCCAAAATTGG + Intronic
1025998513 7:66543559-66543581 CCGCCACACCTGGCCAGCATAGG + Intergenic
1026279074 7:68905564-68905586 CCACCGCGCCTGGCCAATATTGG + Intergenic
1026469262 7:70681135-70681157 CCACCACACTTGGCCAGCACAGG + Intronic
1026621709 7:71955296-71955318 CCACCACACATGGCAATTATGGG + Intronic
1026686913 7:72518772-72518794 GCACCACACCTGGCCTATATGGG + Intergenic
1026987034 7:74561194-74561216 CCACCACACCTGGCTAATTTTGG - Intronic
1027109928 7:75429476-75429498 CCACCACACCTGGCTAATTTTGG - Intronic
1027192401 7:76004414-76004436 CCACCATGCTTGGCCAAGATAGG - Intronic
1027372506 7:77521084-77521106 CCACCACGCCTGGCCAAAAATGG + Intergenic
1027710565 7:81595490-81595512 CCACCGCGCCTGGCCAAATTTGG + Intergenic
1028298155 7:89161675-89161697 CCACCACACCTGGCCTTAATAGG + Intronic
1028568428 7:92259104-92259126 CCACCACACCTGGCTAATTTTGG + Intronic
1028989834 7:97036974-97036996 CCACCGCACCTGGCCCAAACTGG + Intergenic
1029069605 7:97884394-97884416 CCACCACACCTGGCTAATTTTGG - Intergenic
1029142617 7:98422232-98422254 CCACCACACCTGGCTAATTTTGG - Intergenic
1029285043 7:99459699-99459721 CCACCACACCAGGCCAAGATAGG + Intronic
1029415046 7:100437126-100437148 CCACCGCACCTGGCCATAAATGG + Intergenic
1029520811 7:101060924-101060946 CCACCACACCCGGCCCCAATAGG + Intergenic
1029597310 7:101544818-101544840 CCACAACACCTGGCCAAAACAGG + Intronic
1029727538 7:102417140-102417162 CCACCACACCTGGCTAATTTTGG + Intronic
1029924098 7:104297568-104297590 CCACCGCGCCTGGCCAAAAAGGG - Intergenic
1030105416 7:105982828-105982850 CCACCACATCTGGCTAATATTGG - Intronic
1030206442 7:106956773-106956795 CCACCATACCTGGCCAACATAGG - Intergenic
1030307083 7:108029830-108029852 CCACCACGCCTGGCCAAGAAAGG - Intronic
1030606420 7:111643314-111643336 CCACCACACCCGGCCCAAAATGG + Intergenic
1031461102 7:122050288-122050310 CCACCACACCTGGCTAATTTTGG - Intronic
1032003040 7:128278004-128278026 CCACCACACCTGGCCATTTTTGG - Intergenic
1032271627 7:130413317-130413339 CCACCAAACCTGGCCTAAGTTGG - Intronic
1032337698 7:131041738-131041760 CCACCACACTCGGCTAATTTTGG - Intergenic
1032367113 7:131309698-131309720 CCACCACACTCAGCCACAAGTGG + Intronic
1032465991 7:132145393-132145415 CCACCCTACTTGGGTAAAATTGG + Intronic
1032863476 7:135903562-135903584 CCACCACACCCGGCTAAATTTGG - Intergenic
1033073999 7:138231592-138231614 CCACCACACCTGGCCTCACTAGG - Intergenic
1033083871 7:138324343-138324365 CCACCACGCACGGCCAAAAGGGG - Intergenic
1033160009 7:138987127-138987149 CCACCACGCCTGGCCAAAAAAGG - Intergenic
1033358788 7:140623160-140623182 CCACCACACCTGGCTAATTTTGG - Intronic
1033365047 7:140666595-140666617 CCACCACAGTTGGCTAAAACCGG + Intronic
1033475493 7:141688066-141688088 CCACCGCTCTAGGCCAAAGTAGG + Intronic
1033883643 7:145917558-145917580 CCACCACACCTGGCTAATTTTGG - Intergenic
1034145428 7:148867037-148867059 CCACCACGCCTGGCCAAGACTGG - Intronic
1034175699 7:149097984-149098006 CCACCGCGCCCGGCCAAAATGGG + Intergenic
1034268076 7:149790770-149790792 TCCCCACACTTGGCCAAGAAGGG + Intergenic
1034849303 7:154479268-154479290 CCACCACACCTGGCCCAGAGTGG - Intronic
1034912187 7:155005886-155005908 CCACCACACCTGGCTAATTTTGG + Intergenic
1035346455 7:158202944-158202966 CCACCACATCTGGCCGAGATTGG - Intronic
1035678869 8:1473081-1473103 CCACCACACCTGGCTAATTTTGG + Intergenic
1035898584 8:3432799-3432821 CCACTACACATGGCCAACATGGG + Intronic
1036130171 8:6102616-6102638 CCACCACACCCGGCCGAAACTGG + Intergenic
1036248938 8:7145271-7145293 CCACCACACGTGGCTAATTTTGG + Intergenic
1036485010 8:9171496-9171518 CCACCACACCTGGCCAAGCCTGG + Intergenic
1036525972 8:9535200-9535222 CCACCGCGCCCGGCCAAAATGGG - Intergenic
1036632044 8:10522844-10522866 CCACCACTCCTGGCCAGATTGGG - Intergenic
1036888218 8:12576365-12576387 CCACCACGATTGGTCAGAATAGG + Intergenic
1037196185 8:16193257-16193279 CCACCACACCTAGCCAAACATGG - Intronic
1037633593 8:20679988-20680010 CCACCACACCTGGCCAAGACAGG - Intergenic
1037794365 8:21979330-21979352 CCACCACACCTGGCCAAAGCTGG + Intronic
1038224365 8:25642139-25642161 CCACCACACTCAGCCAATTTTGG + Intergenic
1038355036 8:26821175-26821197 CCACCACGCCTGGCCACATTAGG + Intronic
1038418512 8:27415947-27415969 CCACTGCACCTGGCCAGAATTGG - Intronic
1038503639 8:28065445-28065467 CCACCGCGCCTGGCCGAAATTGG + Intronic
1038549843 8:28457670-28457692 CCACAACACTTGGGCATTATGGG + Intronic
1038795084 8:30702782-30702804 CCACCACACTTGGCTAGTTTTGG - Intronic
1039634258 8:39145881-39145903 CCACCACACCTGGCTAATTTTGG + Intronic
1039942936 8:42106888-42106910 CCACCACACCAGGCCAAATTGGG + Intergenic
1040658685 8:49543901-49543923 CCACCCCACTTGGCCTGAAAGGG - Intronic
1040876859 8:52162056-52162078 CCACCACACCTGGCTAATTTTGG - Intronic
1040890777 8:52314093-52314115 CCACCATTCCTGCCCAAAATGGG + Intronic
1041061140 8:54035771-54035793 CCACCACACCTGGCTAATTTTGG + Intergenic
1041240074 8:55841827-55841849 CCACCACGCCTGGCCTGAATGGG - Intergenic
1041366673 8:57113883-57113905 CCACCACTCTTTGCCACAAGGGG - Intergenic
1041875588 8:62683319-62683341 CCACCACGCCTGGCCACTATGGG + Intronic
1042900279 8:73719114-73719136 CCACCACACCTGGCCAAAACTGG - Intronic
1043110610 8:76175353-76175375 CCACTGCACCTGGCCAAAAGAGG + Intergenic
1043988396 8:86721260-86721282 CCACCGCACCTGGCCAGAATTGG + Intronic
1044078909 8:87859798-87859820 CCACCACACCTGGCTAATTTTGG - Intergenic
1044781829 8:95751507-95751529 CCACCACACTTGGCCAGCCTAGG - Intergenic
1044975551 8:97661788-97661810 CCACCACACCTGGCTAATTTTGG - Intronic
1044978766 8:97693866-97693888 CCACCACACCTGGCTAATTTTGG + Intronic
1045201244 8:99983994-99984016 CCACCACACCTGGCCTAAATAGG - Intronic
1045226277 8:100249083-100249105 CCACCACACCTGGCCTCTATAGG + Intronic
1045459575 8:102413761-102413783 CCACCACGCCTGGCCGAGATAGG + Intergenic
1045517810 8:102876178-102876200 CCACCACACCTGGCAAAATTAGG + Intronic
1045589793 8:103581103-103581125 CCACCACACCTGGCCGAGAAGGG + Intronic
1045638195 8:104217419-104217441 CCACCACACCTGGCTAATTTTGG + Intronic
1045958604 8:107939844-107939866 AAACCACACTTAGCTAAAATAGG - Intronic
1045964553 8:108009894-108009916 CCACCACACTTGACTAATTTTGG - Intronic
1046004863 8:108466739-108466761 CCACTGCACCTGGCCAAAATTGG + Intronic
1046264184 8:111810002-111810024 CCACCACACCTGGCCAAAAAAGG - Intergenic
1046683485 8:117197879-117197901 CCACCAAACCTCTCCAAAATAGG - Intergenic
1047279090 8:123429575-123429597 CCACCGCACCTGGCCAAGACAGG - Intronic
1047291096 8:123531267-123531289 CCACCGCACCCGGCCAAAACAGG + Intronic
1047500947 8:125440951-125440973 CCACCACACCTGGCCCATGTTGG - Intergenic
1047569868 8:126085839-126085861 CCACCACACCTGGCCAATGGAGG - Intergenic
1047632894 8:126727542-126727564 CCACCACACTAGGCTAATTTTGG + Intergenic
1047673211 8:127171517-127171539 CCACCACACCTGGCCATAACAGG - Intergenic
1048546587 8:135393174-135393196 CCACCACACTTGCCTATCATAGG - Intergenic
1048673659 8:136752253-136752275 CCAACAGACTTGGCCAAACAGGG - Intergenic
1048771349 8:137898706-137898728 CCACCACACCCGGCCTAAACAGG + Intergenic
1049451216 8:142662870-142662892 CCACAGCACTCGGCCTAAATAGG - Intronic
1049844797 8:144794765-144794787 CCATCACATATGGCTAAAATGGG + Intergenic
1049963317 9:756791-756813 CCACCGCACCCGGCCAACATAGG + Intergenic
1050392477 9:5159882-5159904 CCACCACACCTGGCCACATGTGG - Intronic
1050430270 9:5555125-5555147 CCACCGCACCTGGCCAATAATGG - Intronic
1050468427 9:5958480-5958502 CCACCACACTTGGCTTAAAGTGG - Intronic
1050747525 9:8894064-8894086 CCACCGCACCTGGCCTAGATTGG - Intronic
1051270205 9:15348159-15348181 CCACCACACCCGGCTAAAACAGG - Intergenic
1051390167 9:16555308-16555330 CCACCACACCCGGCCAAGGTTGG + Intronic
1051505860 9:17826878-17826900 CCATCACACTTGCCCATGATTGG + Intergenic
1051807572 9:21012773-21012795 CCACCACGGCTGGCCAAAAGTGG - Intronic
1051837186 9:21353538-21353560 CCACCACACCTGGCTAATTTTGG + Intergenic
1052186594 9:25604229-25604251 CCAACACACTTGGTCAACACAGG - Intergenic
1052644594 9:31217000-31217022 CCACCACACCCGACCAAAAAAGG - Intergenic
1052848449 9:33358984-33359006 CCACCACACCCGGCCTAAATTGG + Intronic
1052965974 9:34340962-34340984 CCACCACGCCTGGCCAGAAGCGG + Intronic
1052985482 9:34483926-34483948 CCACCACACCCAGCCAAAAAAGG - Intronic
1053078235 9:35153156-35153178 CCACCACACCTGGCCACGGTTGG - Intergenic
1053328094 9:37175414-37175436 CCACCACGCCTGGCCTAAAATGG - Intronic
1053340248 9:37320363-37320385 CCACCGCACCTGGCCAACTTCGG + Intronic
1053432686 9:38053522-38053544 CCACCACACCCAGCCAGAATGGG + Intronic
1053508002 9:38661310-38661332 CCACCGCACCTGGCCAATAGTGG + Intergenic
1053556878 9:39146400-39146422 CCACCACACCCGGCCAGGATAGG - Intronic
1053789718 9:41678276-41678298 CCACCACACCTGGCTAACACCGG - Intergenic
1054089858 9:60834817-60834839 CCACCACACCCGGCCAGGATAGG - Intergenic
1054111269 9:61110375-61110397 CCACCACACCCGGCCAGGATAGG - Intergenic
1054155426 9:61636477-61636499 CCACCACACCTGGCTAACACCGG + Intergenic
1054178056 9:61889966-61889988 CCACCACACCTGGCTAACACCGG - Intergenic
1054475212 9:65567588-65567610 CCACCACACCTGGCTAACACCGG + Intergenic
1054609588 9:67220750-67220772 CCACCACACCCGGCCAGGATAGG + Intergenic
1054659473 9:67690858-67690880 CCACCACACCTGGCTAACACCGG + Intergenic
1055064905 9:72109034-72109056 CCACCACACCCAGCCAAAATGGG + Intergenic
1055359781 9:75477320-75477342 CCACCCCACCTTGCCCAAATGGG - Intergenic
1055528464 9:77159065-77159087 ACAACATACTTGGCCAGAATTGG - Intergenic
1055564253 9:77551985-77552007 CCACCACACCTGGCTAATTTTGG - Intronic
1055955836 9:81772883-81772905 CCACCACGCCTGGCCGTAATTGG + Intergenic
1056168198 9:83958349-83958371 CCACCACACCTGGCCCCAAATGG + Intergenic
1056271224 9:84949751-84949773 CCACCACACCTGGCCCTGATTGG + Intronic
1056429600 9:86514152-86514174 CTACCACACTTGGCTAATTTTGG + Intergenic
1056527750 9:87459155-87459177 CCACCACACCCGGCCAACTTTGG + Intergenic
1056805636 9:89726673-89726695 CCACCACGCCTGGCAAGAATAGG + Intergenic
1057104380 9:92397615-92397637 CCACCACACCCGGCCAGCATTGG + Intronic
1057454436 9:95194910-95194932 CCACCAAGCCTGGCCAAACTAGG - Intronic
1057901519 9:98952672-98952694 CCACCACACTTGGCCAGATTAGG + Intronic
1058065277 9:100541661-100541683 CCACCACGCCTGGCCAGATTTGG + Intronic
1058120596 9:101134669-101134691 CCACCACACATGGCTAGAACAGG + Intronic
1058197956 9:102001699-102001721 CCACCGCACCTGGCCGGAATTGG + Intergenic
1058701923 9:107607960-107607982 CCACCACACCTGGCCTATATTGG + Intergenic
1058710787 9:107677321-107677343 CCACCACAGCTGGCCAAATCAGG + Intergenic
1058739071 9:107924368-107924390 CCACCACACCTGGCCAAAAGAGG - Intergenic
1059067916 9:111104512-111104534 CCGCCACACTTGGCTAATTTTGG + Intergenic
1059494222 9:114696468-114696490 CCACCACACCTGGCTAAATTTGG + Intergenic
1059577831 9:115509934-115509956 CCACCGCACCTGGCCAAGAATGG + Intergenic
1059642584 9:116232039-116232061 CCACCGCACCTGGCCAACAGTGG + Intronic
1059978844 9:119747051-119747073 CCACCACACCTGGCCAGTGTGGG - Intergenic
1060648821 9:125306643-125306665 CCACCACACCTGGCTAATTTTGG + Intronic
1060733293 9:126051091-126051113 CCACCGCACCTGGCCAAAATGGG - Intergenic
1061094475 9:128447294-128447316 CCACCACGCCTGGCCTAAAAAGG - Intergenic
1061097863 9:128470341-128470363 CCACCACGCCTGGCCAAGAAGGG - Intronic
1061303895 9:129721866-129721888 CCACCACGCTTGGCCCCAAGGGG + Intronic
1061571556 9:131480881-131480903 CCACCACTCCTGGCCAAAGTTGG - Intronic
1061608001 9:131726044-131726066 CCACTGCACCCGGCCAAAATTGG + Intronic
1061722725 9:132562983-132563005 CCACCCCACCTGGCCGCAATTGG + Intronic
1185772727 X:2777438-2777460 CCACAACACTTGGCTAATTTTGG - Intronic
1185844417 X:3424204-3424226 CCACCACACCTGGCTAATTTTGG - Intergenic
1186007255 X:5086264-5086286 CCACCACTCCCGGCCAGAATTGG + Intergenic
1186746052 X:12570456-12570478 CCACCACACATGGCTAATTTTGG + Intronic
1187012072 X:15289734-15289756 CCACCACACCCGGCCAACCTAGG - Intronic
1187160990 X:16764984-16765006 CCACTGCACCTGGCCAAAAGTGG + Exonic
1187301670 X:18057028-18057050 CCACCACACTTGGCCTGAACTGG + Intergenic
1187794910 X:22993177-22993199 CCACCGCGCTGGGCCAAAAAGGG + Intergenic
1188592615 X:31857089-31857111 CCACCATGCCTGGCCAAGATTGG - Intronic
1189254362 X:39626260-39626282 CCACCACACCTGGCTAATTTTGG + Intergenic
1189295668 X:39915793-39915815 CCACCGCGCCTGGCCAACATAGG - Intergenic
1189465435 X:41274875-41274897 CCACCACACCTGGCCTACATTGG + Intergenic
1189665869 X:43354295-43354317 CCACCACACCTGGCCAAGATTGG + Intergenic
1189793647 X:44626609-44626631 CCACCACACCTGGCCAATACTGG + Intergenic
1189895469 X:45651224-45651246 CCACCACGCCTGGCCCAAGTAGG - Intergenic
1190268547 X:48844583-48844605 CCATTGCACCTGGCCAAAATGGG + Intergenic
1190270842 X:48862110-48862132 CCACCACACCTGGCCAGACTGGG - Intergenic
1190763253 X:53454114-53454136 CCACCGCATCTGGCCACAATAGG + Intergenic
1191732628 X:64353658-64353680 CCACCACCCCTGGCCAATAGTGG - Intronic
1192017021 X:67342078-67342100 CCACCGCACCTGGCCATAATTGG + Intergenic
1192288972 X:69771343-69771365 CCACCACACCTGGCCAAGAAAGG + Intronic
1192317044 X:70061299-70061321 CCACCATACTTGGCTAATTTTGG - Intergenic
1192374027 X:70540925-70540947 CCACCACACCTGGCCAAGATTGG - Intronic
1192449034 X:71231533-71231555 CCACTGCACCTGGCCAACATTGG - Intergenic
1192873561 X:75206949-75206971 CCACCACACTTGGCCAATGATGG + Intergenic
1194352029 X:92832921-92832943 CCACCATCCTTGGCCAAGCTTGG - Intergenic
1195138848 X:101938438-101938460 CCACCACACCTGGCCCACACAGG - Intergenic
1195397638 X:104428525-104428547 CCACTGCACCTGGCCTAAATTGG - Intergenic
1195470365 X:105222860-105222882 CCACCACACATGGCCCCAACAGG - Intronic
1195873809 X:109516840-109516862 CCACCGCGCCTGGCCAACATAGG - Intergenic
1196212720 X:113013271-113013293 CCACCGCACCTGGCCCAAAATGG + Intergenic
1196889601 X:120279260-120279282 CCACCACACTTGGCCCATAGTGG + Intronic
1196949436 X:120862044-120862066 CCACCACACCCGGCCAGAAAGGG + Intergenic
1197166602 X:123384335-123384357 CCACCACGCCTGGCCGAAAAGGG - Intronic
1197185901 X:123587261-123587283 CCACCGCACCTGGCCACATTTGG + Intergenic
1198117742 X:133560449-133560471 CCACCATGCCCGGCCAAAATAGG - Intronic
1198128090 X:133667560-133667582 CCACCACACCCAGCCAATATGGG - Intronic
1198465430 X:136900710-136900732 CCACCACACTTGGCTAATTGTGG + Intergenic
1198555124 X:137784471-137784493 CCACCGCAGTTGGCCAGAATGGG + Intergenic
1198821037 X:140649136-140649158 CCACCACACCTGGCCATGAATGG + Intergenic
1199023659 X:142911947-142911969 CCACCACACCTGGCCGAAGGTGG - Intergenic
1199049318 X:143218330-143218352 CCACAATTTTTGGCCAAAATTGG + Intergenic
1199653495 X:149971492-149971514 CCACCACACCTGGCCAAACGTGG + Intergenic
1201500401 Y:14635877-14635899 CTACCACACCTGGCCGAAAGTGG + Intronic
1202046626 Y:20742218-20742240 CCACCACACCTGGCCAAAAATGG - Intergenic
1202073916 Y:21019432-21019454 CCACTGCACCTGGCCACAATCGG - Intergenic
1202078616 Y:21061286-21061308 CCACTGCACCTGGCCACAATCGG - Intergenic
1202095270 Y:21243196-21243218 CCACCACAGTTGGCCAAAATTGG - Intergenic