ID: 1174664076

View in Genome Browser
Species Human (GRCh38)
Location 20:52240851-52240873
Sequence ATCCCAGGAAACACCCATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174664071_1174664076 30 Left 1174664071 20:52240798-52240820 CCTCAGAGGTAGAGGAGACACAA No data
Right 1174664076 20:52240851-52240873 ATCCCAGGAAACACCCATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174664076 Original CRISPR ATCCCAGGAAACACCCATAA AGG Intergenic
No off target data available for this crispr