ID: 1174664640

View in Genome Browser
Species Human (GRCh38)
Location 20:52246596-52246618
Sequence TGTGATGAAAAATCACCTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174664640_1174664645 14 Left 1174664640 20:52246596-52246618 CCATTAGGTGATTTTTCATCACA No data
Right 1174664645 20:52246633-52246655 CAGTGCAGAAAAAAATGGAAAGG No data
1174664640_1174664644 9 Left 1174664640 20:52246596-52246618 CCATTAGGTGATTTTTCATCACA No data
Right 1174664644 20:52246628-52246650 CGCTGCAGTGCAGAAAAAAATGG No data
1174664640_1174664647 23 Left 1174664640 20:52246596-52246618 CCATTAGGTGATTTTTCATCACA No data
Right 1174664647 20:52246642-52246664 AAAAAATGGAAAGGAATGGCTGG No data
1174664640_1174664646 19 Left 1174664640 20:52246596-52246618 CCATTAGGTGATTTTTCATCACA No data
Right 1174664646 20:52246638-52246660 CAGAAAAAAATGGAAAGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174664640 Original CRISPR TGTGATGAAAAATCACCTAA TGG (reversed) Intergenic
No off target data available for this crispr