ID: 1174666365

View in Genome Browser
Species Human (GRCh38)
Location 20:52261676-52261698
Sequence TCGCATCATCATTGGAGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174666365_1174666369 -10 Left 1174666365 20:52261676-52261698 CCAGGGCTCCAATGATGATGCGA No data
Right 1174666369 20:52261689-52261711 GATGATGCGAGGCCTGGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174666365 Original CRISPR TCGCATCATCATTGGAGCCC TGG (reversed) Intergenic
No off target data available for this crispr