ID: 1174672101

View in Genome Browser
Species Human (GRCh38)
Location 20:52318151-52318173
Sequence CCTTTCCCCAGGTATTTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174672101_1174672108 3 Left 1174672101 20:52318151-52318173 CCATGCAAATACCTGGGGAAAGG No data
Right 1174672108 20:52318177-52318199 TTCCAGGCACAGGAAGTGGCAGG No data
1174672101_1174672106 -7 Left 1174672101 20:52318151-52318173 CCATGCAAATACCTGGGGAAAGG No data
Right 1174672106 20:52318167-52318189 GGAAAGGGTCTTCCAGGCACAGG No data
1174672101_1174672107 -1 Left 1174672101 20:52318151-52318173 CCATGCAAATACCTGGGGAAAGG No data
Right 1174672107 20:52318173-52318195 GGTCTTCCAGGCACAGGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174672101 Original CRISPR CCTTTCCCCAGGTATTTGCA TGG (reversed) Intergenic
No off target data available for this crispr