ID: 1174672105

View in Genome Browser
Species Human (GRCh38)
Location 20:52318162-52318184
Sequence GCCTGGAAGACCCTTTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174672105_1174672108 -8 Left 1174672105 20:52318162-52318184 CCTGGGGAAAGGGTCTTCCAGGC No data
Right 1174672108 20:52318177-52318199 TTCCAGGCACAGGAAGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174672105 Original CRISPR GCCTGGAAGACCCTTTCCCC AGG (reversed) Intergenic
No off target data available for this crispr