ID: 1174672108

View in Genome Browser
Species Human (GRCh38)
Location 20:52318177-52318199
Sequence TTCCAGGCACAGGAAGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174672105_1174672108 -8 Left 1174672105 20:52318162-52318184 CCTGGGGAAAGGGTCTTCCAGGC No data
Right 1174672108 20:52318177-52318199 TTCCAGGCACAGGAAGTGGCAGG No data
1174672101_1174672108 3 Left 1174672101 20:52318151-52318173 CCATGCAAATACCTGGGGAAAGG No data
Right 1174672108 20:52318177-52318199 TTCCAGGCACAGGAAGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174672108 Original CRISPR TTCCAGGCACAGGAAGTGGC AGG Intergenic
No off target data available for this crispr