ID: 1174673641

View in Genome Browser
Species Human (GRCh38)
Location 20:52332227-52332249
Sequence CAAACAAGCCCCAAATAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174673639_1174673641 5 Left 1174673639 20:52332199-52332221 CCGGATAGGGTAGCTTATGTTGC No data
Right 1174673641 20:52332227-52332249 CAAACAAGCCCCAAATAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174673641 Original CRISPR CAAACAAGCCCCAAATAGCA GGG Intergenic
No off target data available for this crispr