ID: 1174676366

View in Genome Browser
Species Human (GRCh38)
Location 20:52360793-52360815
Sequence ATGCATACCAAAAAATAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174676366_1174676369 1 Left 1174676366 20:52360793-52360815 CCATCCTATTTTTTGGTATGCAT No data
Right 1174676369 20:52360817-52360839 TCCAAGGAAGCTGCAGTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174676366 Original CRISPR ATGCATACCAAAAAATAGGA TGG (reversed) Intergenic
No off target data available for this crispr