ID: 1174682428

View in Genome Browser
Species Human (GRCh38)
Location 20:52421660-52421682
Sequence CTGTAGTCCTTGAGTCAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174682428_1174682430 -6 Left 1174682428 20:52421660-52421682 CCTTTTTGACTCAAGGACTACAG No data
Right 1174682430 20:52421677-52421699 CTACAGATTACGTCCTGACTGGG No data
1174682428_1174682429 -7 Left 1174682428 20:52421660-52421682 CCTTTTTGACTCAAGGACTACAG No data
Right 1174682429 20:52421676-52421698 ACTACAGATTACGTCCTGACTGG No data
1174682428_1174682434 25 Left 1174682428 20:52421660-52421682 CCTTTTTGACTCAAGGACTACAG No data
Right 1174682434 20:52421708-52421730 ATCCAGCCCTGCCCCCTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174682428 Original CRISPR CTGTAGTCCTTGAGTCAAAA AGG (reversed) Intergenic
No off target data available for this crispr