ID: 1174683131

View in Genome Browser
Species Human (GRCh38)
Location 20:52427437-52427459
Sequence CTCTTGCAAATTAGAAAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174683131_1174683134 -8 Left 1174683131 20:52427437-52427459 CCCATTTTTCTAATTTGCAAGAG No data
Right 1174683134 20:52427452-52427474 TGCAAGAGAGGCTATTGTAGTGG No data
1174683131_1174683137 27 Left 1174683131 20:52427437-52427459 CCCATTTTTCTAATTTGCAAGAG No data
Right 1174683137 20:52427487-52427509 CAGCTTTTGGCCAGCAGCATTGG No data
1174683131_1174683135 14 Left 1174683131 20:52427437-52427459 CCCATTTTTCTAATTTGCAAGAG No data
Right 1174683135 20:52427474-52427496 GTTCTCCAACTGTCAGCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174683131 Original CRISPR CTCTTGCAAATTAGAAAAAT GGG (reversed) Intergenic
No off target data available for this crispr