ID: 1174692545

View in Genome Browser
Species Human (GRCh38)
Location 20:52521973-52521995
Sequence CCTTATATGGACATGGTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174692541_1174692545 28 Left 1174692541 20:52521922-52521944 CCTGTTGGTGAGCTAGTTAGAAC No data
Right 1174692545 20:52521973-52521995 CCTTATATGGACATGGTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174692545 Original CRISPR CCTTATATGGACATGGTTTG TGG Intergenic
No off target data available for this crispr