ID: 1174699422

View in Genome Browser
Species Human (GRCh38)
Location 20:52592708-52592730
Sequence GGCGGTTCAGGATCATGTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174699422_1174699428 15 Left 1174699422 20:52592708-52592730 CCTCTACATGATCCTGAACCGCC No data
Right 1174699428 20:52592746-52592768 ATTTTCTCCTCAAAGATCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174699422 Original CRISPR GGCGGTTCAGGATCATGTAG AGG (reversed) Intergenic
No off target data available for this crispr