ID: 1174699424

View in Genome Browser
Species Human (GRCh38)
Location 20:52592726-52592748
Sequence AATTGTGGTTTTGGCATAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174699424_1174699430 13 Left 1174699424 20:52592726-52592748 CCGCCTATGCCAAAACCACAATT No data
Right 1174699430 20:52592762-52592784 TCTAAGGTCACGTGACTCTGTGG No data
1174699424_1174699428 -3 Left 1174699424 20:52592726-52592748 CCGCCTATGCCAAAACCACAATT No data
Right 1174699428 20:52592746-52592768 ATTTTCTCCTCAAAGATCTAAGG No data
1174699424_1174699431 19 Left 1174699424 20:52592726-52592748 CCGCCTATGCCAAAACCACAATT No data
Right 1174699431 20:52592768-52592790 GTCACGTGACTCTGTGGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174699424 Original CRISPR AATTGTGGTTTTGGCATAGG CGG (reversed) Intergenic
No off target data available for this crispr