ID: 1174699428

View in Genome Browser
Species Human (GRCh38)
Location 20:52592746-52592768
Sequence ATTTTCTCCTCAAAGATCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174699423_1174699428 3 Left 1174699423 20:52592720-52592742 CCTGAACCGCCTATGCCAAAACC No data
Right 1174699428 20:52592746-52592768 ATTTTCTCCTCAAAGATCTAAGG No data
1174699424_1174699428 -3 Left 1174699424 20:52592726-52592748 CCGCCTATGCCAAAACCACAATT No data
Right 1174699428 20:52592746-52592768 ATTTTCTCCTCAAAGATCTAAGG No data
1174699425_1174699428 -6 Left 1174699425 20:52592729-52592751 CCTATGCCAAAACCACAATTTTC No data
Right 1174699428 20:52592746-52592768 ATTTTCTCCTCAAAGATCTAAGG No data
1174699422_1174699428 15 Left 1174699422 20:52592708-52592730 CCTCTACATGATCCTGAACCGCC No data
Right 1174699428 20:52592746-52592768 ATTTTCTCCTCAAAGATCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174699428 Original CRISPR ATTTTCTCCTCAAAGATCTA AGG Intergenic
No off target data available for this crispr