ID: 1174699430

View in Genome Browser
Species Human (GRCh38)
Location 20:52592762-52592784
Sequence TCTAAGGTCACGTGACTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174699427_1174699430 -2 Left 1174699427 20:52592741-52592763 CCACAATTTTCTCCTCAAAGATC No data
Right 1174699430 20:52592762-52592784 TCTAAGGTCACGTGACTCTGTGG No data
1174699425_1174699430 10 Left 1174699425 20:52592729-52592751 CCTATGCCAAAACCACAATTTTC No data
Right 1174699430 20:52592762-52592784 TCTAAGGTCACGTGACTCTGTGG No data
1174699424_1174699430 13 Left 1174699424 20:52592726-52592748 CCGCCTATGCCAAAACCACAATT No data
Right 1174699430 20:52592762-52592784 TCTAAGGTCACGTGACTCTGTGG No data
1174699423_1174699430 19 Left 1174699423 20:52592720-52592742 CCTGAACCGCCTATGCCAAAACC No data
Right 1174699430 20:52592762-52592784 TCTAAGGTCACGTGACTCTGTGG No data
1174699426_1174699430 4 Left 1174699426 20:52592735-52592757 CCAAAACCACAATTTTCTCCTCA No data
Right 1174699430 20:52592762-52592784 TCTAAGGTCACGTGACTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174699430 Original CRISPR TCTAAGGTCACGTGACTCTG TGG Intergenic
No off target data available for this crispr