ID: 1174702198

View in Genome Browser
Species Human (GRCh38)
Location 20:52620365-52620387
Sequence CCTATTTGGAAATAGAGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174702198_1174702202 -9 Left 1174702198 20:52620365-52620387 CCAAGGCTCTATTTCCAAATAGG No data
Right 1174702202 20:52620379-52620401 CCAAATAGGGCCATATTTGCAGG No data
1174702198_1174702204 25 Left 1174702198 20:52620365-52620387 CCAAGGCTCTATTTCCAAATAGG No data
Right 1174702204 20:52620413-52620435 ATCACTTCAACATATCTTTTCGG No data
1174702198_1174702205 26 Left 1174702198 20:52620365-52620387 CCAAGGCTCTATTTCCAAATAGG No data
Right 1174702205 20:52620414-52620436 TCACTTCAACATATCTTTTCGGG No data
1174702198_1174702206 27 Left 1174702198 20:52620365-52620387 CCAAGGCTCTATTTCCAAATAGG No data
Right 1174702206 20:52620415-52620437 CACTTCAACATATCTTTTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174702198 Original CRISPR CCTATTTGGAAATAGAGCCT TGG (reversed) Intergenic
No off target data available for this crispr