ID: 1174705558

View in Genome Browser
Species Human (GRCh38)
Location 20:52652419-52652441
Sequence CCTTTGATAGCAGAGCTTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174705558_1174705560 -7 Left 1174705558 20:52652419-52652441 CCACTAAGCTCTGCTATCAAAGG No data
Right 1174705560 20:52652435-52652457 TCAAAGGCAGAAATGATGCAAGG No data
1174705558_1174705562 9 Left 1174705558 20:52652419-52652441 CCACTAAGCTCTGCTATCAAAGG No data
Right 1174705562 20:52652451-52652473 TGCAAGGGAATTCCCTAGAAAGG No data
1174705558_1174705563 10 Left 1174705558 20:52652419-52652441 CCACTAAGCTCTGCTATCAAAGG No data
Right 1174705563 20:52652452-52652474 GCAAGGGAATTCCCTAGAAAGGG No data
1174705558_1174705561 -6 Left 1174705558 20:52652419-52652441 CCACTAAGCTCTGCTATCAAAGG No data
Right 1174705561 20:52652436-52652458 CAAAGGCAGAAATGATGCAAGGG No data
1174705558_1174705564 11 Left 1174705558 20:52652419-52652441 CCACTAAGCTCTGCTATCAAAGG No data
Right 1174705564 20:52652453-52652475 CAAGGGAATTCCCTAGAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174705558 Original CRISPR CCTTTGATAGCAGAGCTTAG TGG (reversed) Intergenic