ID: 1174705564

View in Genome Browser
Species Human (GRCh38)
Location 20:52652453-52652475
Sequence CAAGGGAATTCCCTAGAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174705558_1174705564 11 Left 1174705558 20:52652419-52652441 CCACTAAGCTCTGCTATCAAAGG No data
Right 1174705564 20:52652453-52652475 CAAGGGAATTCCCTAGAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174705564 Original CRISPR CAAGGGAATTCCCTAGAAAG GGG Intergenic
No off target data available for this crispr