ID: 1174711342

View in Genome Browser
Species Human (GRCh38)
Location 20:52708655-52708677
Sequence CCTTCCACGAATAAACTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174711342_1174711347 21 Left 1174711342 20:52708655-52708677 CCTTGCAGTTTATTCGTGGAAGG No data
Right 1174711347 20:52708699-52708721 TTTCCACTGTCTAGATTTTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174711342 Original CRISPR CCTTCCACGAATAAACTGCA AGG (reversed) Intergenic
No off target data available for this crispr