ID: 1174716122

View in Genome Browser
Species Human (GRCh38)
Location 20:52760903-52760925
Sequence CTGGTCAGAGGGAGAATTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174716116_1174716122 29 Left 1174716116 20:52760851-52760873 CCTGAATCTCAGGGGTTGCATTC No data
Right 1174716122 20:52760903-52760925 CTGGTCAGAGGGAGAATTGGTGG No data
1174716118_1174716122 -8 Left 1174716118 20:52760888-52760910 CCTTTGCTTCAAAAGCTGGTCAG No data
Right 1174716122 20:52760903-52760925 CTGGTCAGAGGGAGAATTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174716122 Original CRISPR CTGGTCAGAGGGAGAATTGG TGG Intergenic
No off target data available for this crispr