ID: 1174717044

View in Genome Browser
Species Human (GRCh38)
Location 20:52770679-52770701
Sequence GGCTGGTGTCAGAGAGGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174717036_1174717044 -6 Left 1174717036 20:52770662-52770684 CCCCAGTGCCTCCACTTGGCTGG No data
Right 1174717044 20:52770679-52770701 GGCTGGTGTCAGAGAGGCCAGGG No data
1174717033_1174717044 20 Left 1174717033 20:52770636-52770658 CCATTCATGAGACTTGCAGTGAG No data
Right 1174717044 20:52770679-52770701 GGCTGGTGTCAGAGAGGCCAGGG No data
1174717039_1174717044 -8 Left 1174717039 20:52770664-52770686 CCAGTGCCTCCACTTGGCTGGTG No data
Right 1174717044 20:52770679-52770701 GGCTGGTGTCAGAGAGGCCAGGG No data
1174717032_1174717044 21 Left 1174717032 20:52770635-52770657 CCCATTCATGAGACTTGCAGTGA No data
Right 1174717044 20:52770679-52770701 GGCTGGTGTCAGAGAGGCCAGGG No data
1174717031_1174717044 22 Left 1174717031 20:52770634-52770656 CCCCATTCATGAGACTTGCAGTG No data
Right 1174717044 20:52770679-52770701 GGCTGGTGTCAGAGAGGCCAGGG No data
1174717038_1174717044 -7 Left 1174717038 20:52770663-52770685 CCCAGTGCCTCCACTTGGCTGGT No data
Right 1174717044 20:52770679-52770701 GGCTGGTGTCAGAGAGGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174717044 Original CRISPR GGCTGGTGTCAGAGAGGCCA GGG Intergenic
No off target data available for this crispr