ID: 1174718235

View in Genome Browser
Species Human (GRCh38)
Location 20:52783482-52783504
Sequence ACGGAGAATCAGAAAGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174718231_1174718235 23 Left 1174718231 20:52783436-52783458 CCATGTTGCAAAGTGAAGAGAAT No data
Right 1174718235 20:52783482-52783504 ACGGAGAATCAGAAAGTGGCAGG No data
1174718229_1174718235 28 Left 1174718229 20:52783431-52783453 CCCTACCATGTTGCAAAGTGAAG No data
Right 1174718235 20:52783482-52783504 ACGGAGAATCAGAAAGTGGCAGG No data
1174718230_1174718235 27 Left 1174718230 20:52783432-52783454 CCTACCATGTTGCAAAGTGAAGA No data
Right 1174718235 20:52783482-52783504 ACGGAGAATCAGAAAGTGGCAGG No data
1174718228_1174718235 29 Left 1174718228 20:52783430-52783452 CCCCTACCATGTTGCAAAGTGAA No data
Right 1174718235 20:52783482-52783504 ACGGAGAATCAGAAAGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174718235 Original CRISPR ACGGAGAATCAGAAAGTGGC AGG Intergenic
No off target data available for this crispr