ID: 1174719306

View in Genome Browser
Species Human (GRCh38)
Location 20:52794505-52794527
Sequence AAAACAAAGCCGTAAATAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174719302_1174719306 9 Left 1174719302 20:52794473-52794495 CCTCAGTTGACTGTAGGTAACCG No data
Right 1174719306 20:52794505-52794527 AAAACAAAGCCGTAAATAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174719306 Original CRISPR AAAACAAAGCCGTAAATAAG TGG Intergenic
No off target data available for this crispr