ID: 1174720262

View in Genome Browser
Species Human (GRCh38)
Location 20:52804036-52804058
Sequence TGAGAATGAGAAGCAGCAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174720258_1174720262 23 Left 1174720258 20:52803990-52804012 CCCTTTTTTAAGCAAATTTGCTT No data
Right 1174720262 20:52804036-52804058 TGAGAATGAGAAGCAGCAGCCGG No data
1174720259_1174720262 22 Left 1174720259 20:52803991-52804013 CCTTTTTTAAGCAAATTTGCTTC No data
Right 1174720262 20:52804036-52804058 TGAGAATGAGAAGCAGCAGCCGG No data
1174720260_1174720262 0 Left 1174720260 20:52804013-52804035 CCATGTGCACTTTAGAGCCATTC No data
Right 1174720262 20:52804036-52804058 TGAGAATGAGAAGCAGCAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174720262 Original CRISPR TGAGAATGAGAAGCAGCAGC CGG Intergenic
No off target data available for this crispr