ID: 1174720976

View in Genome Browser
Species Human (GRCh38)
Location 20:52812286-52812308
Sequence AAGCTCTGCCAGACTGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174720976_1174720983 5 Left 1174720976 20:52812286-52812308 CCAGGGCCAGTCTGGCAGAGCTT No data
Right 1174720983 20:52812314-52812336 CACAGCTCGGTGACATTGTCAGG No data
1174720976_1174720979 -8 Left 1174720976 20:52812286-52812308 CCAGGGCCAGTCTGGCAGAGCTT No data
Right 1174720979 20:52812301-52812323 CAGAGCTTGGCCCCACAGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174720976 Original CRISPR AAGCTCTGCCAGACTGGCCC TGG (reversed) Intergenic