ID: 1174725341

View in Genome Browser
Species Human (GRCh38)
Location 20:52855838-52855860
Sequence ATGAAGAAAAACAATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174725341_1174725343 3 Left 1174725341 20:52855838-52855860 CCTTCCTCATTGTTTTTCTTCAT No data
Right 1174725343 20:52855864-52855886 TTGAATGAAAGCTTTCAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174725341 Original CRISPR ATGAAGAAAAACAATGAGGA AGG (reversed) Intergenic
No off target data available for this crispr