ID: 1174727856

View in Genome Browser
Species Human (GRCh38)
Location 20:52882249-52882271
Sequence AAGTGCCAAGATAATTCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174727856_1174727859 10 Left 1174727856 20:52882249-52882271 CCCACTGAATTATCTTGGCACTT No data
Right 1174727859 20:52882282-52882304 TGAATTGACCATATATGAGTGGG No data
1174727856_1174727861 21 Left 1174727856 20:52882249-52882271 CCCACTGAATTATCTTGGCACTT No data
Right 1174727861 20:52882293-52882315 TATATGAGTGGGCCTACTTCTGG No data
1174727856_1174727858 9 Left 1174727856 20:52882249-52882271 CCCACTGAATTATCTTGGCACTT No data
Right 1174727858 20:52882281-52882303 ATGAATTGACCATATATGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174727856 Original CRISPR AAGTGCCAAGATAATTCAGT GGG (reversed) Intergenic
No off target data available for this crispr