ID: 1174729944

View in Genome Browser
Species Human (GRCh38)
Location 20:52906255-52906277
Sequence CAATAGCCACAAGTGGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174729941_1174729944 8 Left 1174729941 20:52906224-52906246 CCTCTGTTGCACTAGCTTCTTTG No data
Right 1174729944 20:52906255-52906277 CAATAGCCACAAGTGGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174729944 Original CRISPR CAATAGCCACAAGTGGTGCA GGG Intergenic
No off target data available for this crispr