ID: 1174733096

View in Genome Browser
Species Human (GRCh38)
Location 20:52937522-52937544
Sequence TTGGCTTAACACTGAGGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174733096_1174733104 9 Left 1174733096 20:52937522-52937544 CCAGCGCCTCAGTGTTAAGCCAA No data
Right 1174733104 20:52937554-52937576 GGAAAGAAAATCAAGACTCATGG No data
1174733096_1174733105 20 Left 1174733096 20:52937522-52937544 CCAGCGCCTCAGTGTTAAGCCAA No data
Right 1174733105 20:52937565-52937587 CAAGACTCATGGCTTCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174733096 Original CRISPR TTGGCTTAACACTGAGGCGC TGG (reversed) Intergenic
No off target data available for this crispr