ID: 1174733105

View in Genome Browser
Species Human (GRCh38)
Location 20:52937565-52937587
Sequence CAAGACTCATGGCTTCCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174733103_1174733105 -4 Left 1174733103 20:52937546-52937568 CCTTAGGGGGAAAGAAAATCAAG No data
Right 1174733105 20:52937565-52937587 CAAGACTCATGGCTTCCTCCTGG No data
1174733097_1174733105 14 Left 1174733097 20:52937528-52937550 CCTCAGTGTTAAGCCAAACCTTA No data
Right 1174733105 20:52937565-52937587 CAAGACTCATGGCTTCCTCCTGG No data
1174733096_1174733105 20 Left 1174733096 20:52937522-52937544 CCAGCGCCTCAGTGTTAAGCCAA No data
Right 1174733105 20:52937565-52937587 CAAGACTCATGGCTTCCTCCTGG No data
1174733102_1174733105 1 Left 1174733102 20:52937541-52937563 CCAAACCTTAGGGGGAAAGAAAA No data
Right 1174733105 20:52937565-52937587 CAAGACTCATGGCTTCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174733105 Original CRISPR CAAGACTCATGGCTTCCTCC TGG Intergenic
No off target data available for this crispr