ID: 1174735077

View in Genome Browser
Species Human (GRCh38)
Location 20:52958382-52958404
Sequence ATTGGCTATGCAGTCACGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174735068_1174735077 29 Left 1174735068 20:52958330-52958352 CCTCTGCAAGTCCTCCAAGGAGT No data
Right 1174735077 20:52958382-52958404 ATTGGCTATGCAGTCACGAGGGG No data
1174735073_1174735077 -10 Left 1174735073 20:52958369-52958391 CCTGCCAAGTCACATTGGCTATG No data
Right 1174735077 20:52958382-52958404 ATTGGCTATGCAGTCACGAGGGG No data
1174735070_1174735077 15 Left 1174735070 20:52958344-52958366 CCAAGGAGTTCTCCATGACTCAA No data
Right 1174735077 20:52958382-52958404 ATTGGCTATGCAGTCACGAGGGG No data
1174735071_1174735077 3 Left 1174735071 20:52958356-52958378 CCATGACTCAATTCCTGCCAAGT No data
Right 1174735077 20:52958382-52958404 ATTGGCTATGCAGTCACGAGGGG No data
1174735069_1174735077 18 Left 1174735069 20:52958341-52958363 CCTCCAAGGAGTTCTCCATGACT No data
Right 1174735077 20:52958382-52958404 ATTGGCTATGCAGTCACGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174735077 Original CRISPR ATTGGCTATGCAGTCACGAG GGG Intergenic