ID: 1174741922

View in Genome Browser
Species Human (GRCh38)
Location 20:53022967-53022989
Sequence CTGGTTTTCCAGGACTCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 277}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174741919_1174741922 21 Left 1174741919 20:53022923-53022945 CCATGGCGATGCATTGTGTGTTA 0: 1
1: 0
2: 1
3: 4
4: 65
Right 1174741922 20:53022967-53022989 CTGGTTTTCCAGGACTCTGCTGG 0: 1
1: 0
2: 0
3: 27
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174741922 Original CRISPR CTGGTTTTCCAGGACTCTGC TGG Intronic
900889891 1:5442062-5442084 CAGGTCTTCCAGGGCTCTGGGGG - Intergenic
901081091 1:6584652-6584674 CTTGCTTTCAAGTACTCTGCTGG + Intronic
901814842 1:11788157-11788179 CTGCTTTTCCAGGATCCTGCAGG - Exonic
903362398 1:22784791-22784813 CTGGCCTTCCAGGACTATGGCGG + Exonic
903837049 1:26211209-26211231 CTGGCCTTCCAGGCCTCCGCTGG - Intergenic
904951731 1:34246867-34246889 GTGGTTATCCAGGACACTGCGGG + Intergenic
909829685 1:80172127-80172149 CTGGTTTTAAATGACTCTGAGGG - Intergenic
910089255 1:83442486-83442508 CTGCATTGCCAGGACTCTCCTGG + Intergenic
910432417 1:87172440-87172462 CTGCTTTTCCAGCATACTGCGGG + Intergenic
910538274 1:88324884-88324906 CTGGCTTTCCAGAACAGTGCTGG + Intergenic
912531299 1:110324957-110324979 CTGGTTTTCCCAGTCTGTGCTGG + Intergenic
913259305 1:116984288-116984310 CTGGTATGCCAGGACACTGCAGG - Intronic
915492067 1:156256182-156256204 TTTGTTGTGCAGGACTCTGCAGG - Intronic
916590464 1:166185218-166185240 CTGGTTTGGCAGAACTCTGGAGG - Intergenic
920845876 1:209592595-209592617 GTGGCTTACCAGGACCCTGCTGG - Intronic
921132351 1:212230487-212230509 CTGGATGCCCAGGACTCTGGAGG + Intergenic
921788528 1:219262857-219262879 CTGGTTAGCCAGGACGTTGCAGG + Intergenic
923828805 1:237530415-237530437 TTTGTTTTCCAGGACTTTGTTGG + Exonic
1062969382 10:1634336-1634358 TTGTTTTCCCAGGACTCTCCAGG + Intronic
1064718393 10:18201779-18201801 CTGGTGTTCCAGAAGACTGCAGG - Intronic
1065457177 10:25919023-25919045 CTGAATTTCCAGGACTGTCCTGG + Intergenic
1065592636 10:27280906-27280928 CTGGTTTTCCAGGTATTCGCAGG - Intergenic
1065657728 10:27969378-27969400 CTGGTTTTCCAGGTATTCGCAGG + Intronic
1067017417 10:42768623-42768645 CTGGGATTACAGGACGCTGCAGG + Intergenic
1067260493 10:44685665-44685687 CTGCTTTTTCAGGACTATGGAGG - Intergenic
1067956899 10:50801507-50801529 CTGGTTTTCCAGGACAGTCCTGG - Exonic
1068862019 10:61856891-61856913 CTGGTTTTCCAAGACTTTCCTGG - Intergenic
1068913332 10:62402330-62402352 ATTGTTTTCCAGTATTCTGCAGG + Intronic
1070325058 10:75383434-75383456 CTGGTCTCCCAGGACCCTGGAGG - Intergenic
1071604247 10:86973666-86973688 CTGTTTTCCCAGTACTCTGAAGG + Intronic
1072553820 10:96499182-96499204 GTGGTTTTCCTGAACACTGCTGG - Intronic
1073118635 10:101107968-101107990 CTGGTCATGCAGGACTTTGCTGG - Intronic
1074588582 10:114791309-114791331 CTGCTTTTAAAGGCCTCTGCTGG + Intergenic
1076201615 10:128563504-128563526 CTGCTGTTCCAGGACTCAGCAGG + Intergenic
1076286072 10:129297650-129297672 CTAGTTTCCCATGATTCTGCAGG + Intergenic
1076619727 10:131779508-131779530 CAGGCTTCCCAGGACCCTGCAGG - Intergenic
1079428787 11:20368613-20368635 CTTTTGTTCCAGGACACTGCAGG + Intronic
1081573010 11:44303138-44303160 CTGGCTCTCCAGGGCTCTGAAGG - Intronic
1082798885 11:57399066-57399088 CTGTGTTTCCAGAACTGTGCAGG - Intronic
1083326666 11:61876440-61876462 GTGGCTTTCCAGGACCCTGTGGG + Exonic
1083637567 11:64128727-64128749 CTGGTTTCCCACGCCTCTGCTGG + Intronic
1085514022 11:77102081-77102103 CTGGTTTATCAGGGCTCTGTGGG - Intronic
1085920197 11:80945502-80945524 CTTGTATTCCAGGACTCACCTGG + Intergenic
1087868912 11:103266891-103266913 CTGTTTGTCCTGAACTCTGCAGG - Intronic
1087973729 11:104517798-104517820 TTGGTTTGAAAGGACTCTGCAGG + Intergenic
1088598388 11:111456225-111456247 CGGGATTCCCAGGACTCAGCAGG - Intronic
1090242227 11:125192280-125192302 CTGGCTTTGCACGGCTCTGCCGG - Intronic
1091287353 11:134415017-134415039 ACGGTTTTACAGGACTCTTCTGG - Intergenic
1092318348 12:7443198-7443220 CTGGTTTTCTAGAAATGTGCTGG + Intronic
1098929078 12:76389056-76389078 CTGGTTTTCCAAGAAATTGCTGG + Intronic
1102078278 12:110077221-110077243 CTTGGTTTCCATGACTCTCCTGG + Intergenic
1103739826 12:123083701-123083723 CTGGTGTTCCAGGACCTTCCTGG - Intronic
1103917558 12:124383934-124383956 CTGGCTTTCCAGGCTTCCGCAGG - Intronic
1106514340 13:30440129-30440151 CTGGCTTTCCAGGACTGTCATGG + Intergenic
1106592412 13:31109306-31109328 CTGGTCTTCCACTTCTCTGCTGG - Intergenic
1109197620 13:59395802-59395824 TTTGTTTTCCAGTTCTCTGCTGG + Intergenic
1113462726 13:110493208-110493230 CAGGTTTTCCGGGACTCCGTGGG + Exonic
1116776744 14:49189940-49189962 TTGGTTTTCCAGAGCTCTGTTGG - Intergenic
1117288143 14:54307264-54307286 CTGGTTTTACAGGAAGCAGCTGG - Intergenic
1119741646 14:77017634-77017656 CTTGGTTTCCTGGGCTCTGCAGG + Intergenic
1120109156 14:80532645-80532667 ATGGCTTTCCAGAATTCTGCAGG + Intronic
1121031328 14:90661002-90661024 CTGCTTTTAAAGGACTCTCCTGG - Intronic
1202921713 14_KI270723v1_random:34293-34315 CTGGCTCTCCAGGCCTCTCCAGG - Intergenic
1124059323 15:26274711-26274733 CTGGGCTTCAAGAACTCTGCTGG + Intergenic
1125577811 15:40767252-40767274 CAGCTTGTCCAGGACTATGCGGG - Exonic
1127172759 15:56320781-56320803 CAGGTTTGCCAGGACAATGCTGG - Intronic
1127716165 15:61651276-61651298 GTGGGTTTCAAGGACTTTGCAGG + Intergenic
1128218689 15:65952483-65952505 CAGGTATTTCAGGACTCTGCTGG + Intronic
1129110136 15:73332384-73332406 CTGCTCTGCCTGGACTCTGCAGG + Intronic
1129187967 15:73922249-73922271 CTAGATTTGCAGGTCTCTGCTGG + Intergenic
1130528954 15:84731120-84731142 CTGCTTTTCCAGTACTTTCCTGG + Intergenic
1131394806 15:92077753-92077775 CAGGTTCTTCAGCACTCTGCAGG + Intronic
1131559886 15:93430513-93430535 CTGTATCTCCAGGCCTCTGCAGG + Intergenic
1132519146 16:379428-379450 CAGGCTTTCCAGGTGTCTGCTGG + Intronic
1133694386 16:8247708-8247730 CTGTTTCTCTAGAACTCTGCAGG + Intergenic
1136277937 16:29190632-29190654 CTGGTGCTCCAGGAGTCTGTAGG - Intergenic
1137568750 16:49550952-49550974 CTGGGTTTGCAGGAAGCTGCTGG + Intronic
1137805541 16:51301650-51301672 CTGATTTTCCTGCACTCAGCTGG + Intergenic
1139340868 16:66267107-66267129 CGGGTTTTCCTGGACTGTGGGGG + Intergenic
1139630345 16:68227986-68228008 CTGTTATTCCAGGAGACTGCAGG + Exonic
1140328979 16:74034341-74034363 GTGGTTTTCCAGGACTTTAAAGG - Intergenic
1141079969 16:81041829-81041851 CTTCTTTTCCTGGATTCTGCAGG - Intronic
1141478851 16:84292840-84292862 CTGGGTTTACAGGACTCTGATGG + Intergenic
1142177930 16:88653398-88653420 CTGCTTTTCCAGGTTTCTGAAGG - Exonic
1143336308 17:6174180-6174202 CGGGTTGTCCAGGATGCTGCTGG + Intergenic
1143418090 17:6764975-6764997 CTGGTTTTCAAGGACATTGGTGG + Intronic
1146455191 17:33004284-33004306 CTGGTTTTCCTGAGCTCTGGGGG + Intergenic
1150994818 17:70305250-70305272 CTGGTTTGCCAGGACTCAGTGGG - Intergenic
1151109523 17:71659106-71659128 CTGATCTTCCAGAACTCTGAAGG - Intergenic
1152196055 17:78919122-78919144 CTGGAGTTTCAGGACTCTCCAGG - Intronic
1152705777 17:81842927-81842949 CTGCTTTACCTGGACTCTGATGG - Intergenic
1154283331 18:13028092-13028114 CTGGTTCTCCCGGCTTCTGCTGG + Intronic
1156514371 18:37667785-37667807 CTTGTTTTCCAGGGTTCAGCTGG + Intergenic
1157575468 18:48740344-48740366 CAGGTTTTGGAGGACTCTGGAGG - Intronic
1157831766 18:50862577-50862599 CTGCTTTCACAGGAGTCTGCAGG + Intergenic
1157935406 18:51866548-51866570 CTCTTTTTCCAGGGCTCTGTAGG - Intergenic
1160116256 18:76082109-76082131 CTGCTTTTCCAGGACTTAACTGG + Intergenic
1160121464 18:76134007-76134029 CTGGTTTTCAAGGATACTGTAGG + Intergenic
1161546679 19:4885186-4885208 CTGGGTTTTCCGGAATCTGCTGG + Intergenic
1161546774 19:4885751-4885773 CTGGGTTTTCCGGAATCTGCTGG + Intergenic
1161547093 19:4887973-4887995 CTGGGTTTTCCGGAATCTGCTGG + Intergenic
1162787897 19:13047046-13047068 CTAGTTATCCAGGACTCTTAAGG + Intronic
1163207673 19:15815503-15815525 CTGGTTCCCCAGGTCTCTCCTGG + Intergenic
1165137373 19:33678119-33678141 CTGGCTTTCCAACACTCTGTGGG + Intronic
1165363944 19:35352497-35352519 CTGCTTCTCCAGGCCCCTGCGGG + Exonic
1165940862 19:39414053-39414075 CTCTTTCTGCAGGACTCTGCTGG + Exonic
1166295938 19:41889472-41889494 CTGGGTTTTCTAGACTCTGCGGG - Intronic
1166481273 19:43176244-43176266 CTGGCTTTCAAGGACTCTGGTGG - Intronic
925232390 2:2245313-2245335 CTCCTTCTCCAGGACTCTACAGG - Intronic
925232426 2:2245677-2245699 CTCCTTCTCCAGGACTCTACAGG + Intronic
925280533 2:2681486-2681508 CTTGCCTTCCAGGACACTGCAGG - Intergenic
925996913 2:9300951-9300973 CTGGTTTTCCAGGCCAGCGCCGG + Intronic
927142923 2:20141958-20141980 ATTGATTTCCAGGACCCTGCTGG - Intergenic
928181280 2:29070765-29070787 CTGTTCTTCCAGCATTCTGCTGG + Exonic
928393438 2:30926703-30926725 CTAGGCTTCCAGAACTCTGCAGG - Intronic
929061233 2:37926028-37926050 CAGGTTTTCCAGGACGCTGTAGG + Intronic
929590755 2:43144330-43144352 CTGAATTTCCAGGACTTTTCAGG + Intergenic
929665687 2:43832068-43832090 GTGGTTTTCCCGGAGCCTGCGGG + Exonic
930104860 2:47631855-47631877 CTGGTTTTAAAGGACAGTGCTGG - Intergenic
931032790 2:58199863-58199885 CTTATTTTTCAGTACTCTGCTGG + Intronic
931384829 2:61788862-61788884 CTGATTTTCCAGGAGAATGCTGG - Intergenic
931840832 2:66146486-66146508 CTAGTTTCCCTGTACTCTGCTGG - Intergenic
932347835 2:71007298-71007320 CTGGCTTTCCACCCCTCTGCTGG + Intergenic
932706659 2:74031264-74031286 CTGGGTTTCCGTGACCCTGCCGG - Intronic
934476697 2:94598441-94598463 CTGGTTTTCCAGGGCCCGGATGG - Intronic
934579564 2:95427450-95427472 CTGGTGTCCCGGGACGCTGCAGG + Intergenic
934599880 2:95649275-95649297 CTGGTGTCCCGGGACGCTGCAGG - Intergenic
934881371 2:97983375-97983397 CTAGTTTTTCAGGTCTCTTCGGG + Intronic
935132120 2:100268636-100268658 GTGGATTTCAAGGACTCTGGGGG - Intergenic
936380868 2:111984807-111984829 CTGGTCTTCCAAGACTGAGCAGG + Intronic
936510171 2:113138818-113138840 CTGGTTTTTCAAGACTCTCTAGG + Intergenic
938072132 2:128314349-128314371 TTTTTTTTCCTGGACTCTGCAGG - Intronic
938712438 2:133987093-133987115 CTGTTTTGCTAGGATTCTGCAGG - Intergenic
942155678 2:173124708-173124730 CTGGATCTCCTGCACTCTGCTGG + Intronic
943807933 2:192146865-192146887 CTGGTTGTCTATGAGTCTGCAGG + Intronic
944009160 2:194952170-194952192 CTGGTTTTCTAAGACCCTGCTGG + Intergenic
945478145 2:210310771-210310793 CTGGTTACACAGGACTGTGCAGG + Intronic
945903947 2:215569664-215569686 CTGGTATTCCAGTTCTCTGCAGG - Intergenic
946060289 2:216935307-216935329 CTACTTTTCCAGGACTCCTCCGG + Intergenic
946105789 2:217368324-217368346 CTGGCTTTCTAGGCCTGTGCAGG - Intronic
946865828 2:224039902-224039924 CTGGGTTCCCAGGACGCTGCGGG - Intergenic
947961824 2:234246050-234246072 TGGGTTTTCCAAGACTTTGCGGG + Intergenic
1169201528 20:3712554-3712576 CTGGCTCCCCAGGGCTCTGCCGG + Intergenic
1169397866 20:5250836-5250858 CTGGTTAGCCAGGATGCTGCAGG + Intergenic
1171204538 20:23268512-23268534 CTGGGTGTCCAGGGCTGTGCTGG - Intergenic
1172054125 20:32142329-32142351 CTGATTCTCCAGGGCTGTGCTGG - Intronic
1172931280 20:38588102-38588124 TTGGTTTTCCTGGAGTCAGCAGG + Exonic
1172962527 20:38808454-38808476 AAGGTTTTCCTGGTCTCTGCTGG - Intronic
1174127702 20:48319410-48319432 CTGGTTCTCCATGACCCTGCAGG + Intergenic
1174453915 20:50636483-50636505 CTGGGTAACCAGCACTCTGCAGG + Intronic
1174741922 20:53022967-53022989 CTGGTTTTCCAGGACTCTGCTGG + Intronic
1175803527 20:61814351-61814373 CAGGTTTTCCAGGGCCCTTCAGG - Intronic
1176052627 20:63128537-63128559 CCTATTTTCCAGGACTCTGCAGG + Intergenic
1178819390 21:35961644-35961666 CTGTTTTTCCAGGTACCTGCTGG + Intronic
1179026188 21:37680727-37680749 CTGGGTCTCCAGGAAACTGCAGG + Intronic
1179793867 21:43771122-43771144 CTGGATCTCCAGGACACTGATGG - Intergenic
1179805883 21:43836681-43836703 CTGGTTTTCAAGGCTACTGCAGG - Intergenic
1183408164 22:37640377-37640399 CTGCTTTTCCTGGACTCAGGTGG + Intronic
1184032118 22:41901208-41901230 CTGAATCTCCAGGACTCTCCCGG - Intronic
1184662482 22:45971798-45971820 CCGCTGGTCCAGGACTCTGCTGG + Intronic
1184865143 22:47198092-47198114 CTGGTTCTCCCGGAGCCTGCTGG + Intergenic
1184942388 22:47778546-47778568 CTCATTTCCCAGGACTCTCCTGG - Intergenic
949226940 3:1705803-1705825 CTGGTTTTCCAGGCCTCACTGGG - Intergenic
951681450 3:25298899-25298921 CAGGTATTCCAGGTCTCTCCAGG - Intronic
951853162 3:27165865-27165887 CTTCTTGGCCAGGACTCTGCTGG - Intronic
952891969 3:38049207-38049229 CTGGTTTCTCAGGTCTCTGCTGG + Intronic
954397539 3:50300879-50300901 CTGGTCAGCCAGGACTTTGCAGG + Intronic
954783646 3:53077813-53077835 ATGGTTTTCTTGGCCTCTGCAGG + Exonic
955207348 3:56908294-56908316 TAAGATTTCCAGGACTCTGCAGG + Intronic
956101830 3:65776577-65776599 CTGGTTTTCCAGGCAGCTGCAGG + Intronic
957668020 3:83261885-83261907 CTGATTTTCCTGAACTTTGCTGG - Intergenic
957681409 3:83440376-83440398 CTGGTTAGCCAGGATTTTGCAGG - Intergenic
958889182 3:99764102-99764124 ATGGTTTTCCAGGCCTCTGGTGG - Intronic
961647985 3:128402775-128402797 CTGGTTTTCCAAGAACCTGAAGG - Intronic
961794806 3:129401841-129401863 CTTGTTTTCCAGGAAGCTGAAGG - Exonic
963124237 3:141800096-141800118 CTGGTTCTTTATGACTCTGCTGG - Intronic
965026329 3:163305363-163305385 CTGCTATTACAGGACTCTGATGG - Intergenic
965440347 3:168705109-168705131 TTGGAGTTCCAGGACACTGCTGG - Intergenic
966084746 3:176056390-176056412 CAGGTTTTCAAAGACTCTACTGG + Intergenic
966413932 3:179670031-179670053 ATGCTTCTCCAGGACCCTGCTGG + Intronic
966553367 3:181230341-181230363 CTGGTTAGCCAGGACGTTGCAGG + Intergenic
967093876 3:186160753-186160775 CTGGTTTTCAGGGCCTCTGCTGG - Intronic
968818111 4:2832152-2832174 CTGGCTGGCCAGGGCTCTGCTGG + Intronic
969058344 4:4415747-4415769 CAGGTCTTGCAGGACTCTGCTGG + Intronic
969285102 4:6198217-6198239 GTGATTTTCCCAGACTCTGCCGG - Intronic
969453112 4:7286166-7286188 CTGGGTCTCCAGGCCTGTGCCGG + Intronic
969704857 4:8786149-8786171 CTGGGCTCCCAGGGCTCTGCTGG - Intergenic
971200810 4:24507821-24507843 CTGGTTTTCCAGCAGTGGGCAGG - Intergenic
971564352 4:28118481-28118503 CAGGGATTCCAGGACTCTACAGG - Intergenic
973331322 4:48912835-48912857 CTGCTTGTCCAGGTCTCTCCAGG - Intergenic
975299122 4:72768513-72768535 CTGCTGTTCCAAGTCTCTGCTGG - Intergenic
977571321 4:98632532-98632554 CTGGTTTTCCGTGACAGTGCTGG - Intronic
979479594 4:121200787-121200809 CTGGGGTTCCAGAAATCTGCTGG - Intronic
980213668 4:129822818-129822840 CTGTTTTTCCAGGTGTCAGCTGG - Intergenic
980428830 4:132663744-132663766 CTATTATTCCAGGTCTCTGCTGG + Intergenic
981543149 4:145866470-145866492 ATGGTTCTCCAGGACTAGGCAGG + Intronic
982986898 4:162221337-162221359 TTGATTGTTCAGGACTCTGCAGG + Intergenic
982998820 4:162386517-162386539 CTTGTCTTGCAGGACTGTGCCGG - Intergenic
983489141 4:168368166-168368188 CTGGGTTTCCAGACCTCTGATGG - Intronic
985585966 5:734451-734473 CTGGTTATCCAGGATGTTGCAGG - Intronic
985600385 5:825863-825885 CTGGTTATCCAGGATGTTGCAGG - Intronic
985731666 5:1553031-1553053 CGGGATTTCCAGGGCTGTGCTGG - Intergenic
986543399 5:8870498-8870520 CTGGTCTTCCGGGTGTCTGCTGG + Intergenic
986916164 5:12623550-12623572 CTGGTTATCCAGGATGATGCAGG + Intergenic
988120413 5:26954174-26954196 CTGGATTACCAGGTCTCTGTTGG + Intronic
988237958 5:28571356-28571378 CAGTATTTCTAGGACTCTGCTGG - Intergenic
988585606 5:32505074-32505096 CTCTTTTTCCAGCACTCTCCTGG - Intergenic
991214773 5:64149372-64149394 CTGGTTATCCAGAATACTGCAGG + Intergenic
993137374 5:83986724-83986746 CAGGTTCACCTGGACTCTGCTGG - Intronic
996072574 5:119150314-119150336 CTAGTTTACCAGGACTCAGCCGG + Exonic
997726958 5:136129530-136129552 ATTGTTTCCAAGGACTCTGCTGG + Intergenic
997897444 5:137732327-137732349 CTAGATTTCCAGGTCTCTCCTGG - Intronic
998000464 5:138621140-138621162 CTGATGTTCCAGGAGTCTACAGG + Intronic
998628616 5:143873951-143873973 CTGGTTATCCAGGAATTTGGGGG + Intergenic
1001340459 5:170838848-170838870 CTCCTTGTCCAGGACTATGCTGG + Intergenic
1001684746 5:173585002-173585024 TTGGATTTGCAGGACTCAGCTGG - Intergenic
1003187092 6:3841347-3841369 CTGGTTTTCCATGAAGCTGGGGG + Intergenic
1003838246 6:10093758-10093780 CTAGGTTTCCAGGACTGTGATGG + Intronic
1004328799 6:14702078-14702100 CTTGTTTTTCAGCACTCAGCAGG - Intergenic
1005831498 6:29674624-29674646 TTGGTTTTCCAGGACAGTCCTGG - Intronic
1006784834 6:36659355-36659377 CTGGTTTACCAGCACACTACTGG - Intergenic
1007109231 6:39303544-39303566 CTGGGGTTCCAGGAGTCTCCCGG + Intronic
1007751157 6:44072848-44072870 TGGGGTGTCCAGGACTCTGCTGG - Intergenic
1010055435 6:71558677-71558699 CTGGTTATCCAGGATGTTGCAGG + Intergenic
1011512821 6:88120127-88120149 CTTTTTTTCCGTGACTCTGCAGG - Intergenic
1011614037 6:89181703-89181725 AATGCTTTCCAGGACTCTGCAGG - Intronic
1012235237 6:96806344-96806366 CTGGCTTTTCTGGACTCTGGAGG + Intronic
1012341229 6:98126861-98126883 GTGATTTTCAAGGTCTCTGCAGG - Intergenic
1013733634 6:113200846-113200868 CTGGTTTTGCCTGACTCTGGAGG - Intergenic
1017153046 6:151298231-151298253 CTGATTTTCTAGGACTGGGCAGG - Intronic
1018353492 6:162987883-162987905 CTGGTTATCCAGGATGCTGCAGG + Intronic
1018817941 6:167350014-167350036 CTGGGTTTCGATGACTCTTCAGG + Intronic
1018924664 6:168197868-168197890 CTGGGATTCCTGGACTCAGCAGG - Intergenic
1021554969 7:21909889-21909911 CTTGGTTTCCAGGGGTCTGCTGG - Intronic
1021948708 7:25753612-25753634 CTGTTTTTCTAGGACTCTTATGG + Intergenic
1022096836 7:27146562-27146584 CTGGTTTCCAAGGACTCCACAGG - Intronic
1022212516 7:28225380-28225402 CAGGGTTTGGAGGACTCTGCAGG + Intergenic
1023073280 7:36458850-36458872 CTGGTTTTCCTGGACCCTAAAGG - Intergenic
1024229851 7:47355456-47355478 CTGATTCTCCAGGGCTCTGACGG - Intronic
1024328007 7:48127545-48127567 CTGGTTTTCCAGGATGTTGCAGG + Intergenic
1026152887 7:67803091-67803113 CTGGTTTTCCAAGTCGCTGAAGG + Intergenic
1026205276 7:68251859-68251881 CTAGCTTTCCAGGACTCCCCTGG + Intergenic
1027306113 7:76898924-76898946 CTGCATTGCCAGGACTCTCCCGG + Intergenic
1030278124 7:107742123-107742145 CTGGATTTCCATGAATCTGAAGG + Intergenic
1031441722 7:121802817-121802839 CTGAGTTTCCAGTACTCTACAGG + Intergenic
1031980030 7:128118877-128118899 CTGGATACCCAGGCCTCTGCTGG + Intergenic
1031990833 7:128197856-128197878 CTGGTTTTCCAGCTCTGTCCAGG - Intergenic
1032292957 7:130606378-130606400 CTGGTTCTTAAGGACACTGCTGG + Intronic
1032398108 7:131605299-131605321 CTGGGTTCTGAGGACTCTGCAGG - Intergenic
1033663342 7:143418795-143418817 CGGGGTTTCCAGGACTGTGCAGG + Intergenic
1036674291 8:10817202-10817224 CACGGTTTCCAGGACTCTGGAGG + Intronic
1037142903 8:15539879-15539901 ATGGTTTCCCAGGGCTCTGAAGG + Intronic
1038062528 8:23928829-23928851 ATGGTTTTTCAGGACTCAGTGGG - Intergenic
1038545485 8:28422989-28423011 CTGGTTTGCCAGGGCTGTCCTGG - Intronic
1039829186 8:41199536-41199558 CTAGTTTTTCAGGGCTCTTCTGG - Intergenic
1042990022 8:74628938-74628960 ATGGTTTTCCAGTAGTCTGATGG + Intronic
1043537758 8:81225520-81225542 CTGGTGATCCAGGATGCTGCAGG + Intergenic
1046630594 8:116619260-116619282 GTGGTTCTGCTGGACTCTGCTGG - Intergenic
1047367516 8:124225419-124225441 GTGGTTTTCATAGACTCTGCTGG - Intergenic
1047529417 8:125661570-125661592 CTGCACTTCCATGACTCTGCTGG - Intergenic
1048511218 8:135064478-135064500 CAGCTTTTCCAGGATTCTGATGG + Intergenic
1049821109 8:144634183-144634205 CTGGAACTCCAGGCCTCTGCAGG + Intergenic
1049821116 8:144634224-144634246 CTGGAACTCCAGGCCTCTGCAGG + Intergenic
1049821123 8:144634265-144634287 CTGGAACTCCAGGCCTCTGCAGG + Intergenic
1049821130 8:144634306-144634328 CTGGAACTCCAGGCCTCTGCAGG + Intergenic
1049821137 8:144634347-144634369 CTGGAACTCCAGGCCTCTGCAGG + Intergenic
1049821144 8:144634388-144634410 CTGGAACTCCAGGCCTCTGCAGG + Intergenic
1049821151 8:144634429-144634451 CTGGAACTCCAGGCCTCTGCAGG + Intergenic
1049821158 8:144634470-144634492 CTGGAACTCCAGGCCTCTGCAGG + Intergenic
1049821165 8:144634511-144634533 CTGGAACTCCAGGCCTCTGCAGG + Intergenic
1049821172 8:144634552-144634574 CTGGAACTCCAGGCCTCTGCAGG + Intergenic
1049821179 8:144634593-144634615 CTGGAACTCCAGGCCTCTGCAGG + Intergenic
1049821186 8:144634634-144634656 CTGGAACTCCAGGCCTCTGCAGG + Intergenic
1049821193 8:144634675-144634697 CTGGAACTCCAGGCCTCTGCAGG + Intergenic
1049821200 8:144634716-144634738 CTGGAACTCCAGGCCTCTGCAGG + Intergenic
1049821207 8:144634757-144634779 CTGGAACTCCAGGCCTCTGCAGG + Intergenic
1049821214 8:144634798-144634820 CTGGAACTCCAGGCCTCTGCAGG + Intergenic
1049821221 8:144634839-144634861 CTGGAACTCCAGGCCTCTGCAGG + Intergenic
1050332410 9:4558586-4558608 CTTGTACTCCAGGACTCAGCTGG - Intronic
1051498261 9:17749082-17749104 CTGGTTTTCCAGACTTCTGAAGG - Intronic
1052853333 9:33391464-33391486 CTGGTTTTCCAGGGCCCGGATGG + Intronic
1053681365 9:40487636-40487658 CTGGTTTTCCAGGGCCCGGATGG + Intergenic
1053931355 9:43115966-43115988 CTGGTTTTCCAGGGCCCGGATGG + Intergenic
1054282348 9:63137298-63137320 CTGGTTTTCCAGGGCCCGGATGG - Intergenic
1054294454 9:63323152-63323174 CTGGTTTTCCAGGGCCCGGATGG + Intergenic
1054392475 9:64627640-64627662 CTGGTTTTCCAGGGCCCGGATGG + Intergenic
1054427123 9:65132849-65132871 CTGGTTTTCCAGGGCCCGGATGG + Intergenic
1054503252 9:65888690-65888712 CTGGTTTTCCAGGGCCCGGATGG - Intronic
1055581895 9:77714636-77714658 CTTGTTTTGCAGGAATCTACGGG + Intergenic
1056768750 9:89461645-89461667 CAGGCTTCCCAGGACTCTGGGGG - Intronic
1057444316 9:95103308-95103330 CAGGTTTTCCAGGCGGCTGCAGG - Intronic
1058404165 9:104653098-104653120 CTGTTTCTCCAGAATTCTGCTGG - Intergenic
1059255663 9:112928730-112928752 ATGTTTGTCCAGGTCTCTGCAGG - Intergenic
1061095419 9:128454182-128454204 ATGGTTTTCCAGGCTTCTGAGGG + Intergenic
1061702046 9:132423345-132423367 CTGGGTTTCCAGGAGGCTCCTGG + Intronic
1061993387 9:134172282-134172304 CTGGATTTCTCCGACTCTGCAGG + Intergenic
1189238741 X:39509127-39509149 CCTGCTGTCCAGGACTCTGCTGG - Intergenic
1190799585 X:53775153-53775175 CTGGTTCTCCAGGCCTCTCATGG + Intergenic
1191784488 X:64903228-64903250 CTGGTTAGCCAGGACGTTGCAGG + Intergenic
1192886271 X:75337713-75337735 CTGGTTAGCCAGGATGCTGCAGG + Intergenic
1194696931 X:97064240-97064262 CTGCTTTTCAAAGACTCTCCTGG + Intronic
1197823645 X:130566248-130566270 GTGCTTTTCCAGGCCTCTGCCGG - Intergenic
1198799514 X:140434386-140434408 CAGTTTGTCCAGGACTCTTCTGG + Intergenic
1200167243 X:154045253-154045275 CAGGTTTTCCTGGGCACTGCTGG + Intronic
1201564227 Y:15348761-15348783 CTTGTTTTCCCAGACTGTGCTGG - Intergenic