ID: 1174742174

View in Genome Browser
Species Human (GRCh38)
Location 20:53025768-53025790
Sequence CAGTGCACACAGGCCCCCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174742172_1174742174 -5 Left 1174742172 20:53025750-53025772 CCTCTCTTGAACTCTCTGCAGTG No data
Right 1174742174 20:53025768-53025790 CAGTGCACACAGGCCCCCAAAGG No data
1174742171_1174742174 12 Left 1174742171 20:53025733-53025755 CCTGTCACAAAATGAATCCTCTC No data
Right 1174742174 20:53025768-53025790 CAGTGCACACAGGCCCCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174742174 Original CRISPR CAGTGCACACAGGCCCCCAA AGG Intronic