ID: 1174742174

View in Genome Browser
Species Human (GRCh38)
Location 20:53025768-53025790
Sequence CAGTGCACACAGGCCCCCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 188}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174742171_1174742174 12 Left 1174742171 20:53025733-53025755 CCTGTCACAAAATGAATCCTCTC 0: 1
1: 0
2: 0
3: 14
4: 165
Right 1174742174 20:53025768-53025790 CAGTGCACACAGGCCCCCAAAGG 0: 1
1: 0
2: 1
3: 14
4: 188
1174742172_1174742174 -5 Left 1174742172 20:53025750-53025772 CCTCTCTTGAACTCTCTGCAGTG 0: 1
1: 0
2: 3
3: 19
4: 200
Right 1174742174 20:53025768-53025790 CAGTGCACACAGGCCCCCAAAGG 0: 1
1: 0
2: 1
3: 14
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174742174 Original CRISPR CAGTGCACACAGGCCCCCAA AGG Intronic
900540951 1:3202404-3202426 CAGTGCACAGGGGCCCCACAGGG - Intronic
900547559 1:3237092-3237114 CTGTGTGCACGGGCCCCCAAGGG - Intronic
901397243 1:8990207-8990229 CATTGCACTCAGGCTCCCAGAGG - Intergenic
901447981 1:9319705-9319727 CAGTGCAGAGCAGCCCCCAAAGG + Intronic
902039045 1:13479614-13479636 CGGTGCACACAAGCCCACCAGGG + Intronic
902244673 1:15112726-15112748 CAGTGCACAAAGCCCCCGCAGGG + Intronic
903216939 1:21848589-21848611 CAGGGCACACCAGCCCCCAATGG - Intronic
904909225 1:33921648-33921670 CAGAGCAAACAGGCCCTCAGAGG + Intronic
908162146 1:61421038-61421060 CAGTGGACTGAGGCCACCAAGGG - Intronic
908682874 1:66682118-66682140 CAGGTCCCACAGGCCCCCCAGGG + Exonic
911112091 1:94199800-94199822 CAATCCACACAGGGCCACAAGGG - Intronic
912249330 1:107994378-107994400 CAGCTCACACATGACCCCAAGGG + Intergenic
915240143 1:154515443-154515465 CGGTTCACACAGGGCCGCAAGGG - Intronic
916579579 1:166095490-166095512 AAGAGTACACATGCCCCCAAAGG - Intronic
920696014 1:208181725-208181747 CAGTGAACTCGGGCCCACAACGG - Intronic
923705788 1:236343717-236343739 CCATGCACAAAGGCCCCAAAGGG + Intergenic
1064955832 10:20908433-20908455 CAGTGAAAACAAGCCCCCATGGG + Intronic
1065312302 10:24428176-24428198 CACTGCAGAAAGGCCACCAATGG - Intronic
1070305445 10:75236267-75236289 CAATTCACATATGCCCCCAAGGG - Intergenic
1074298863 10:112215285-112215307 CCGTGCAAACAGGCACCCAGAGG - Intronic
1076734564 10:132452900-132452922 CAGTGCCCACAGCCCACCTAGGG + Intergenic
1077084033 11:738842-738864 CAGTGCACCCAGCCCCACAGAGG - Intergenic
1077367013 11:2165396-2165418 CACTGCACCCAGGTCCCCGAGGG + Intronic
1079439616 11:20497755-20497777 CAGTTCACACAGGGCTGCAAGGG + Intronic
1084333769 11:68445505-68445527 CAGTTCTCTCAGGCCCCCTAGGG - Intronic
1085459628 11:76685819-76685841 CAGTGCTCACAGACACCCGAAGG + Intergenic
1085759098 11:79226471-79226493 CATTGAACACAGGCCCTCACGGG + Intronic
1087393878 11:97571950-97571972 CAGTTCACACAAGCCTCCACAGG - Intergenic
1090077918 11:123591035-123591057 CAGTGCAGACAGTCACCCCAAGG - Intronic
1090639473 11:128718006-128718028 GAGGGCTCAGAGGCCCCCAAGGG - Intronic
1091166321 11:133479544-133479566 CTGTGCACACAGGCCCTGAAGGG + Intronic
1095938710 12:47711874-47711896 AGGTTCACACAGGCCCCTAATGG - Intronic
1096270328 12:50161142-50161164 CAGTCAACAGAGGCCCACAAAGG + Intronic
1102925537 12:116823214-116823236 CAGTGCATAGAGGCCCAGAATGG + Intronic
1103916900 12:124380437-124380459 CAGTGCCCACAGGGCCCACAGGG + Intronic
1104642541 12:130476584-130476606 CAGCACACACAGGCCCCCTTGGG - Intronic
1104886712 12:132114524-132114546 CAGTGAACACTGGCGCCCACAGG + Intronic
1104898211 12:132174454-132174476 CAGTGGAGAAAGGTCCCCAAAGG - Intergenic
1106369778 13:29120737-29120759 CAATGCACATCGGACCCCAAGGG - Intronic
1106805227 13:33299598-33299620 CTGAGCACACAGGACCTCAAGGG - Intronic
1113518332 13:110920054-110920076 CAGTGCACAGAGGCATCCAGGGG - Intergenic
1114032915 14:18591107-18591129 CAGTGAACACAAGGCCCCAGTGG + Intergenic
1114361875 14:21983203-21983225 CATTGCAAACAGGTCCCCCAGGG + Intergenic
1118782046 14:69014958-69014980 CATTGCCCACAGGCCCTCAGAGG - Intergenic
1119125432 14:72121408-72121430 CAGTGTAGACAGGCCTACAATGG - Intronic
1122119395 14:99543897-99543919 CAGTGCCCACAGCCCACAAATGG + Intronic
1123068998 14:105632075-105632097 CAGTGCACACAGCCCCACCTGGG - Intergenic
1124454365 15:29827087-29827109 GAGTGCACAAAAGCCCCAAACGG + Intronic
1127401505 15:58591163-58591185 CAGAGCAAACAGGGACCCAATGG + Exonic
1128046126 15:64618963-64618985 CCGTGGACACAGGCCCCTGATGG + Intronic
1128811141 15:70573635-70573657 CTGTGATCACCGGCCCCCAATGG + Intergenic
1128835515 15:70806154-70806176 CAGTTCACACCTTCCCCCAAGGG + Intergenic
1130536171 15:84786558-84786580 CAGAGGACTCAGCCCCCCAAAGG + Intronic
1131183377 15:90255611-90255633 CACTGCACCAAGGACCCCAAGGG - Intronic
1132668917 16:1094837-1094859 CAGTGCACACAGGGCCTCCTGGG + Exonic
1137314106 16:47298973-47298995 CCCTGCACTCAGGCCCCCCATGG + Intronic
1138474494 16:57262897-57262919 CAGTGCTCACAGGGCCCCCCAGG + Intronic
1138638612 16:58364380-58364402 CAATGTGCACAGGCCCCCAGTGG + Intronic
1139076249 16:63452560-63452582 CAGTGAACACATGCCACCTAAGG + Intergenic
1139292533 16:65871683-65871705 CAGCTCACACGGGCTCCCAAGGG - Intergenic
1140197308 16:72865795-72865817 CAGGGCACACAGCCCCACAGAGG - Intronic
1140519427 16:75568560-75568582 CAGGGCCCACAGGCTCCCAGTGG - Intronic
1141962458 16:87418410-87418432 CAGTGCACACGCACCCCCATAGG - Intronic
1142260808 16:89041754-89041776 AAGTGCTCACAGGCACCCACGGG - Intergenic
1142286051 16:89171982-89172004 CTCCGCTCACAGGCCCCCAAAGG - Intronic
1142291111 16:89193936-89193958 CAGTACACACAGGCACGCACAGG + Intronic
1143183165 17:4996714-4996736 GAGTGCACATAGGCTCCCGAAGG + Intronic
1143725990 17:8846892-8846914 CAGGGAACACAGGCCTACAAGGG - Intronic
1146364772 17:32214185-32214207 CAGTGCCCACAGGTCCCGGATGG + Intronic
1148131435 17:45264691-45264713 CAGTGCACACTGGCCCCTGATGG - Exonic
1149291822 17:55225088-55225110 CATAGCTCACAGGCCCCCATAGG + Intergenic
1151199263 17:72455754-72455776 CAGCGCCCACAGGCACCCAGAGG + Intergenic
1151361741 17:73593188-73593210 CACTGAACACAGCCCCCCAGTGG - Intronic
1152671472 17:81610223-81610245 CAGTGCACGCATTTCCCCAAAGG + Exonic
1155174450 18:23290306-23290328 CAGGGCAATCAGGCCCCCATTGG - Intronic
1155651695 18:28151139-28151161 CAGTGCAGTCAGCCCCCCTAAGG - Intronic
1156338372 18:36188743-36188765 CAGTTCTCACAGCCCCCAAAGGG - Intronic
1156365608 18:36423610-36423632 CACTGCACACAGCCCCTCTATGG - Intronic
1156499444 18:37548030-37548052 CAGTACACACAGACACCCATAGG - Intronic
1160226104 18:77012275-77012297 CAGTGCCCACAGGGCCCCCCGGG - Intronic
1161608168 19:5226138-5226160 CAGTGCTCACAGGCGCCCTCTGG - Intronic
1161647914 19:5465712-5465734 CAGTCAACACAGGCTCCCCAAGG - Intergenic
1162786828 19:13040330-13040352 CAAAGCACACAGCCCCCCAGAGG + Intronic
929088049 2:38187993-38188015 CAGAGCACACAGGCCTTCATGGG + Intergenic
931427753 2:62186418-62186440 CAAAACACAAAGGCCCCCAAAGG - Intergenic
931503513 2:62898094-62898116 CAGGTCACACAGGGCCTCAAAGG + Intronic
931973294 2:67614600-67614622 CTGTGCACACAGAATCCCAAGGG + Intergenic
932272003 2:70419109-70419131 CTCTTCACACAGGCCCCCTAAGG - Intergenic
936009594 2:108916956-108916978 CAGGCCACCCAGGCCACCAAAGG + Intronic
936947130 2:117941072-117941094 CAGTCCACAAAGGCCACCACCGG - Intronic
937856033 2:126672563-126672585 CAGAGCACACAGGACCCTTAGGG + Intronic
943642942 2:190378950-190378972 CAATGAACACAGGTCCCTAAGGG + Intergenic
943872053 2:193012085-193012107 ACCTGCACACAAGCCCCCAATGG - Intergenic
944199097 2:197086258-197086280 AAGTGCACACACACCACCAATGG - Intronic
945183049 2:207111338-207111360 CAGTGCGCACAGGCCACATAAGG + Intronic
947635070 2:231676110-231676132 CAGCACACACAGGCACCCAGGGG + Intergenic
947752521 2:232540308-232540330 CAGTCCCCACAGGCCACCAATGG - Intronic
947874616 2:233459936-233459958 CAGTGCACACAAGAGCCCACAGG - Intronic
948242817 2:236452503-236452525 CACTGCACAGAAGCCTCCAAAGG + Intronic
948784937 2:240347447-240347469 CAGGGCAGACAGACGCCCAAAGG + Intergenic
948944612 2:241213164-241213186 CATGGCACACAGGCCCGCAGGGG + Intronic
1171009842 20:21503251-21503273 CATTTCCCACAGGCCCCCAGTGG - Intergenic
1171474951 20:25401337-25401359 CAGTGAACACAGGCCGCTAAAGG - Intergenic
1172229288 20:33326240-33326262 CAGTGGACCCAGGCCCCCTAGGG - Intergenic
1174742174 20:53025768-53025790 CAGTGCACACAGGCCCCCAAAGG + Intronic
1177121510 21:17142549-17142571 CATTTGACACAGGACCCCAAGGG + Intergenic
1179628279 21:42660761-42660783 CAGTGCACTCAGCCACCCAGGGG + Intronic
1179888841 21:44325876-44325898 CAGTGCAGACAGGATCCCCACGG - Intronic
1179905009 21:44418282-44418304 CATCGCACACCTGCCCCCAAGGG - Intronic
1180071737 21:45440205-45440227 CTGTGCACACAGGCTCCCGCTGG + Intronic
1180250323 21:46581961-46581983 CAGTGCACCCACTCCACCAAGGG - Intergenic
1180457030 22:15518164-15518186 CAGTGAACACAAGGCCCCAGTGG + Intergenic
1183711433 22:39506035-39506057 CTGTGCAGACAGGCTCCCATGGG - Intronic
1183828819 22:40407384-40407406 CAGTGAACACAGGCCCACCAAGG - Intronic
1184038890 22:41932017-41932039 CAGTGAAGAAAGGCTCCCAAGGG - Intergenic
1185376353 22:50484255-50484277 CAGTGCACGGAGGCCTCCACAGG - Exonic
950359557 3:12440896-12440918 CAGAGAACACAGGCCTCCGAGGG - Intergenic
950969288 3:17170304-17170326 AACTGCTCCCAGGCCCCCAAAGG + Intronic
950995745 3:17494431-17494453 CAGTGCACCCACTCCACCAAGGG - Intronic
951651232 3:24953898-24953920 CAGTGGACACAGGACCACTAGGG + Intergenic
953848147 3:46445108-46445130 CAGTGCACCCACGCCTCCAGGGG + Intronic
954143315 3:48621467-48621489 CGGCGCTCACAGGCCACCAAGGG - Exonic
954982829 3:54761688-54761710 CAGGGGAAACAGGGCCCCAAAGG - Intronic
955059248 3:55482192-55482214 CAGGGCAAAGAGGCCCCCAGCGG + Intronic
956955486 3:74333954-74333976 CAGTGCAAACAGTCCTACAAGGG + Intronic
957616714 3:82538397-82538419 CAGTGCACCCAGGTCCACACTGG + Intergenic
960680100 3:120238801-120238823 CAGTGCACCCAGTCCCCCAAGGG - Intronic
962377400 3:134869981-134870003 CAGTGCTCACAGCCCTGCAATGG - Intronic
966012041 3:175090456-175090478 AGTTGCACACAGGGCCCCAAAGG + Intronic
969251480 4:5971207-5971229 CAGAGCCCAAAGGCCCCCATCGG + Intronic
969456512 4:7303014-7303036 CTGTGCACACAGCACCCCAGGGG - Intronic
969670694 4:8588465-8588487 CAGTGCACACGGGCACCCGGTGG + Intronic
969717267 4:8873780-8873802 CAGTTCACACAGGCTCCCCTGGG + Intergenic
972726536 4:41750570-41750592 AAGTGCACACTGGTCACCAAGGG - Intergenic
973343784 4:49032450-49032472 CACTGCACACATCCCACCAAGGG - Intronic
973623844 4:52751735-52751757 CAGTGGACACAGGTGGCCAATGG - Intergenic
976598322 4:86914904-86914926 CAATGCAAACAGGCCCACCACGG + Intronic
976846670 4:89496505-89496527 CACTGCACACAGACCCCAAATGG - Intergenic
977924465 4:102684464-102684486 CGGAGCACATATGCCCCCAACGG - Intronic
981001880 4:139836223-139836245 AAATTCACACAGGACCCCAAAGG + Intronic
982224552 4:153153677-153153699 CAGCGCACAAAGGTCCCCACGGG - Intronic
985166353 4:187099220-187099242 CAGTGAACACAGGACCCAAGGGG - Intergenic
985494813 5:198504-198526 CAGGGCACACAGGAGCCCACTGG + Exonic
985571128 5:645890-645912 CCGTCCACACAGGCCGCCGACGG - Intronic
985571148 5:646020-646042 CTGTCCACACAGGCCGCCGATGG - Intronic
985571155 5:646085-646107 CCATCCACACAGGCCGCCAATGG - Intronic
986223105 5:5788144-5788166 CAGTGCACACAGGGCCACACAGG + Intergenic
986820396 5:11460552-11460574 AAATGCACAGGGGCCCCCAATGG - Intronic
987222597 5:15805620-15805642 TAGTCCACACAGGGACCCAAAGG + Intronic
990960692 5:61390912-61390934 TAGTGGACAAAGGCCCCCAGAGG + Intronic
991618204 5:68518356-68518378 CAGGGCACACAGACACCCAGAGG - Intergenic
999194878 5:149775052-149775074 CAATGAACACAGCCCACCAAAGG - Intronic
1000682691 5:164205588-164205610 CATTACACACAGGCTCCTAAAGG + Intergenic
1002278863 5:178119514-178119536 CAGTGCTCACCTGCCCCTAATGG + Intronic
1003458036 6:6301908-6301930 CAGTGCAGACAGGGCCCCCGTGG - Intronic
1004513852 6:16305646-16305668 CAGTGCAGTCAGGCCCCATAGGG + Exonic
1006292156 6:33146450-33146472 CAGCCCCCAAAGGCCCCCAAAGG - Intergenic
1006839856 6:37021795-37021817 CTGTGCAGACAGGCTCTCAAAGG - Intronic
1007276239 6:40676186-40676208 CACTGCAAACAGACCCCCTAAGG + Intergenic
1009928329 6:70146846-70146868 CAGGGGACATAGGCCCACAAGGG + Exonic
1015347580 6:132178196-132178218 GAGTTCTCACAGGCCTCCAAAGG + Intergenic
1017235330 6:152112472-152112494 GAGTACACAAAGGCCACCAAAGG + Intronic
1018092253 6:160355421-160355443 CAGCGCACACAAGAGCCCAAGGG - Intronic
1018153591 6:160963706-160963728 CAGTGCACACTGATCCCAAAAGG + Intergenic
1019213044 6:170421828-170421850 CACTGGACACAGGTCCTCAAGGG - Intergenic
1019213393 6:170424041-170424063 TACTGCACTCAGGCCCCCAATGG + Intergenic
1019308610 7:348020-348042 CAGAACACAGAGGCCCCCACCGG + Intergenic
1020271405 7:6598629-6598651 CTGTGCACACAGGCAGCCTAAGG + Intronic
1020274735 7:6617112-6617134 AGGTGCCCACAGGCCCCCAAAGG - Intronic
1025818824 7:64944875-64944897 CACTGCACCCAGGGCCACAAAGG + Intergenic
1026463259 7:70632832-70632854 CAGAGGACACAGACCCCCACTGG + Intronic
1026647691 7:72186526-72186548 CAGTGAACACAGGGCCCAACAGG + Intronic
1026999683 7:74643707-74643729 AGGTGCCCACAGGCCACCAAAGG + Intergenic
1027188238 7:75984235-75984257 CAGCCCTCCCAGGCCCCCAAGGG + Intronic
1028343074 7:89746470-89746492 CATTGAATACAGGCCCCCCAGGG + Intergenic
1034632823 7:152543949-152543971 CAGAGCCCAGAGGCCCCCCAGGG - Intergenic
1035351384 7:158248574-158248596 CAGTGCACACATGCCACACACGG + Intronic
1035993219 8:4515782-4515804 CAGTGCACACAGGCCGTCTTTGG - Intronic
1037672723 8:21029135-21029157 CTGGCCACACAGGACCCCAAGGG + Intergenic
1045478679 8:102575480-102575502 CATTTCTCACAGGCCCCCAAGGG + Intergenic
1046715395 8:117561359-117561381 CTGTGCACATAGGAGCCCAAGGG - Intergenic
1048079489 8:131110090-131110112 CACTTCACACAGGCCCCCATTGG - Intergenic
1048353493 8:133634760-133634782 CAGTGCACTCATGGCCCCCAGGG + Intergenic
1049423604 8:142527470-142527492 CAGAACCCACAGGCACCCAAGGG - Intronic
1049646986 8:143739927-143739949 GAGAGCCCACAGGCCCCCACAGG + Intergenic
1051528912 9:18078131-18078153 CCGTGCTCACAAGCCCCAAATGG - Intergenic
1057559061 9:96113194-96113216 CAGTGGAGACAGGCTCCCAGCGG - Intronic
1062595886 9:137299012-137299034 CAGGGCCCCCAGGGCCCCAAGGG + Intergenic
1062731346 9:138111819-138111841 CAGGGCACACAGGCCTCCTCGGG + Intronic
1186913347 X:14193345-14193367 CAGTGCACCCATTCCACCAAGGG - Intergenic
1187188717 X:17012599-17012621 CAGAGTTCACAGGCTCCCAAAGG - Intronic
1193164283 X:78263871-78263893 CAGTGCACCCCCTCCCCCAATGG - Intergenic
1195105889 X:101601062-101601084 CAGTGCCTACAGGCACCAAATGG - Intergenic
1195106994 X:101612705-101612727 CAGTGCCTACAGGCACCAAATGG + Intergenic
1195174839 X:102305495-102305517 CGGTGCTCACAGGACCGCAAAGG - Intergenic
1195184026 X:102381598-102381620 CGGTGCTCACAGGACCGCAAAGG + Intronic
1199950714 X:152703738-152703760 CAGTGCACACCAGCCCCAAATGG - Intergenic
1199958968 X:152764723-152764745 CAGCGCACACCAGCCCCAAATGG + Intergenic
1200018863 X:153185222-153185244 CAGTGCACACCAGCCTCAAATGG - Intergenic
1201161943 Y:11173271-11173293 CAGTGCAGGCGGGCGCCCAACGG + Intergenic
1202274331 Y:23099913-23099935 CAGAGCACACAGTCCCCTAGGGG + Intergenic
1202291695 Y:23320764-23320786 CAGAGCACACAGTCCCCTAGGGG - Intergenic
1202427326 Y:24733658-24733680 CAGAGCACACAGTCCCCTAGGGG + Intergenic
1202443465 Y:24936436-24936458 CAGAGCACACAGTCCCCTAGGGG - Intergenic