ID: 1174742206

View in Genome Browser
Species Human (GRCh38)
Location 20:53025983-53026005
Sequence GGCTGTGGTATGGCAGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 202}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174742202_1174742206 -5 Left 1174742202 20:53025965-53025987 CCCGTTAGGATTGCAGGAGGCTG 0: 1
1: 0
2: 1
3: 10
4: 138
Right 1174742206 20:53025983-53026005 GGCTGTGGTATGGCAGTGTCTGG 0: 1
1: 0
2: 0
3: 13
4: 202
1174742197_1174742206 21 Left 1174742197 20:53025939-53025961 CCCTGAGAAAAGCGACAGAAGTA 0: 1
1: 0
2: 1
3: 12
4: 170
Right 1174742206 20:53025983-53026005 GGCTGTGGTATGGCAGTGTCTGG 0: 1
1: 0
2: 0
3: 13
4: 202
1174742203_1174742206 -6 Left 1174742203 20:53025966-53025988 CCGTTAGGATTGCAGGAGGCTGT 0: 1
1: 0
2: 1
3: 11
4: 122
Right 1174742206 20:53025983-53026005 GGCTGTGGTATGGCAGTGTCTGG 0: 1
1: 0
2: 0
3: 13
4: 202
1174742198_1174742206 20 Left 1174742198 20:53025940-53025962 CCTGAGAAAAGCGACAGAAGTAG 0: 1
1: 0
2: 1
3: 18
4: 135
Right 1174742206 20:53025983-53026005 GGCTGTGGTATGGCAGTGTCTGG 0: 1
1: 0
2: 0
3: 13
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174742206 Original CRISPR GGCTGTGGTATGGCAGTGTC TGG Intronic
900463338 1:2811607-2811629 GGCTGTGTGGTGGCAGTTTCAGG + Intergenic
900827616 1:4939241-4939263 GGCTGCAGTTTGGCAGTGGCTGG - Intergenic
907309477 1:53531064-53531086 GGCTGTGACATGGCAATGACAGG + Intronic
908389072 1:63669238-63669260 GGCTCTGATGTAGCAGTGTCTGG - Intergenic
917962195 1:180154443-180154465 GGCTGTTGTAGGGCAGTTCCTGG - Intergenic
919807988 1:201392078-201392100 GTCTGTGGTAAGGCAAGGTCAGG + Intronic
919899641 1:202034567-202034589 GGGCGTGGTATGGCAGAGCCAGG + Intergenic
920061094 1:203227483-203227505 GACTCTGGCATGTCAGTGTCTGG + Intronic
920283948 1:204866225-204866247 GGCTGAGGTTTGGCAGTGTGAGG - Intronic
922867392 1:228871841-228871863 GACTGGTGTCTGGCAGTGTCAGG - Intergenic
923105455 1:230850534-230850556 GCCTGTGGGATGGCAGTGCAGGG + Intronic
923629830 1:235642573-235642595 GGCTGTGGTTTTGCAGAGGCGGG + Intronic
1063231480 10:4069607-4069629 GCCTGTGGTGGAGCAGTGTCGGG - Intergenic
1066760063 10:38741368-38741390 GGCTGGGCCATGGCAGTGTCTGG - Intergenic
1067348343 10:45454401-45454423 GGGGGTGGGCTGGCAGTGTCTGG - Intergenic
1068440927 10:57053876-57053898 GGCTGTGGTGGGGCACTGGCAGG - Intergenic
1069229763 10:65995473-65995495 GGCTGTGGTAAGGCTTTGTAGGG + Intronic
1070161044 10:73866917-73866939 GGATGTGGCATCACAGTGTCAGG - Intronic
1070439457 10:76429061-76429083 GGCAGTGGCATGCCAGTGTGGGG - Intronic
1070648067 10:78215216-78215238 TGCTGTGGTATGGGAGTCCCAGG + Intergenic
1072937916 10:99731243-99731265 AGCTTTGGGGTGGCAGTGTCCGG + Intronic
1073758849 10:106609199-106609221 AGCTGTTGTTTGTCAGTGTCTGG - Intronic
1076550077 10:131272661-131272683 GGCTGTGGTGTGGGAGGATCAGG - Intronic
1077031186 11:468697-468719 GGCTGTGGGAGGGGAGTCTCTGG + Intronic
1078376220 11:10795510-10795532 TACTGTGGAATGGCAGTATCTGG - Intergenic
1081944002 11:46972418-46972440 GTCTGTGGGATGGCAGTGCAGGG + Intronic
1083173399 11:60935612-60935634 GGCTGGAGTATGGCAGTGGGAGG + Intronic
1084117477 11:67050509-67050531 GGCTGGGCCATGGCTGTGTCAGG - Exonic
1084250491 11:67894736-67894758 GGCTGTGTTAGGGCATTGTGGGG + Intergenic
1084304774 11:68274783-68274805 GGCTCTGGAATGGCACTGCCTGG + Intergenic
1085249785 11:75135382-75135404 GGCTCTGGGAGGGCAGCGTCTGG - Intronic
1088050989 11:105515675-105515697 GTCTGTGGGCTGGCAGTGACTGG - Intergenic
1092420822 12:8330258-8330280 GGCTGTGTTAGGGCATTGTGGGG + Intergenic
1096101480 12:48972711-48972733 GGCTGCGGTCTGGCAGGGGCGGG - Intergenic
1096239412 12:49951647-49951669 GGCTGTGGTGTGTCCGTGCCTGG - Intronic
1099243438 12:80165658-80165680 GCCTGAGGTTTGGCAGTGGCTGG + Intergenic
1100355653 12:93826781-93826803 CGCTGAGGTCTGGGAGTGTCTGG - Intronic
1100809616 12:98325254-98325276 GGCTGTGGTATGCAAGGGTAGGG + Intergenic
1102166986 12:110814657-110814679 GGCTGTGATCTGGCTGTGTTGGG + Intergenic
1104586914 12:130055023-130055045 GGTTGTGGTATGGTGGTGTGTGG - Intergenic
1104885329 12:132104128-132104150 GGCTGGGGGATGGCAGTGTGAGG - Exonic
1105782254 13:23715512-23715534 AGCTGCGGTATGGCGGTGGCGGG + Intergenic
1106057308 13:26250529-26250551 GGCTCTGGTATGGCTGAGTCAGG - Intergenic
1106202548 13:27552651-27552673 TGCTGTGGTTGGTCAGTGTCGGG - Intronic
1108714042 13:53061352-53061374 GGCTCTGGGCTGGCAGTGCCTGG - Intergenic
1113227561 13:108176057-108176079 GGCTGTGGAAATGCAGTGTGAGG + Intergenic
1113406272 13:110043327-110043349 GGCTGTGGTGTGTCTGTGTGTGG - Intergenic
1118118795 14:62812269-62812291 GGCTGTTCTATGGCAGTGGCGGG - Intronic
1122419841 14:101568556-101568578 GGCAGTGCTATGGCAGTGAAAGG + Intergenic
1122625904 14:103085259-103085281 GGGTGGGGTGTGGCAGTGGCTGG - Intergenic
1123421578 15:20140537-20140559 GACTGTGCCATGGCAGTGCCTGG + Intergenic
1123530804 15:21147077-21147099 GACTGTGCCATGGCAGTGCCTGG + Intergenic
1123888286 15:24749097-24749119 GGCTGGGCTGTGGCAGTGCCTGG - Intergenic
1124413155 15:29453134-29453156 GACTGTGGTGTGGCATTGGCAGG - Intronic
1125920876 15:43524954-43524976 GGCTCTTGGTTGGCAGTGTCTGG - Exonic
1126264138 15:46732857-46732879 AGTTGTGCTATGGCTGTGTCTGG - Intergenic
1128496302 15:68200482-68200504 GCCCGTGGGATGGCTGTGTCAGG - Intronic
1129336461 15:74854793-74854815 AGCTGTGGTGTGGCAGAGGCAGG - Intronic
1129888438 15:79055063-79055085 GGCTGTGGTGGGGCAGGCTCAGG + Intronic
1130078111 15:80707721-80707743 TGCTGTGGTTTGGGAGGGTCAGG + Intronic
1130651495 15:85764495-85764517 GGCTCTGGGATGACAGGGTCTGG + Intronic
1131455428 15:92579413-92579435 GGCTCTGTTCTGGCAGTGACAGG - Intergenic
1132561945 16:599285-599307 GGCTCTGCCAAGGCAGTGTCAGG + Intronic
1132693153 16:1190655-1190677 GACGGTGGTATAGCAGGGTCTGG - Intronic
1132729971 16:1356403-1356425 CGCTCAGGTATGGCTGTGTCTGG + Intronic
1132758872 16:1499435-1499457 GCCTGTGATTTGGCAGTGGCTGG + Intronic
1132895759 16:2228652-2228674 GGCTGCGGTGTGGGAGGGTCCGG + Intronic
1133359540 16:5163308-5163330 GGCTGTGTTAGGGCATTGTGGGG + Intergenic
1136009586 16:27354767-27354789 GGCTGTGCGGTGGCAGGGTCAGG - Intronic
1136396000 16:29992841-29992863 GGCTGTTGGATGACAGGGTCTGG + Exonic
1136618650 16:31413466-31413488 GGCTGGGGGAAGGCAGTGGCTGG - Intronic
1136671313 16:31861079-31861101 GGCTGTAGTAGGGCAGTCACTGG + Intergenic
1139480598 16:67228504-67228526 GGCTTTAGTCTGGCAGTGTATGG + Exonic
1140451633 16:75075458-75075480 CGCTGTGGTATGGCAGTTACTGG + Intronic
1141015420 16:80444507-80444529 GGCTGGGGAAGGGGAGTGTCAGG - Intergenic
1141417267 16:83885579-83885601 GGCTGTGGTATGTGAGCGTGGGG - Intergenic
1142562800 17:820991-821013 AGCTGTGGCATGGCAGAGACGGG + Intronic
1142562804 17:821014-821036 AGCTGTGGCATGGCAGAGACGGG + Intronic
1142562814 17:821062-821084 AGCTGTGGCATGGCAGAGACGGG + Intronic
1142673394 17:1498030-1498052 GCCGGCGGTATGGGAGTGTCGGG + Exonic
1143794495 17:9325806-9325828 GGCTGAGGAATGCCAGTATCTGG - Intronic
1144782324 17:17814333-17814355 GGCTGTGCCAAGGCAGAGTCTGG - Exonic
1144959181 17:19035277-19035299 AGCTGTGGTGTGGCAGCCTCTGG - Intronic
1144975978 17:19139247-19139269 AGCTGTGGTGTGGCAGCCTCTGG + Intronic
1147565785 17:41535865-41535887 GGCTGGGGGATGGTAGTGGCAGG - Intergenic
1151386633 17:73759116-73759138 GGCAGAGGCATGGCAGAGTCTGG - Intergenic
1151890370 17:76947845-76947867 GCCTCTGGTAGGGCAGGGTCTGG - Exonic
1152784614 17:82241303-82241325 GGCTGAGGGACGGCAGCGTCCGG - Intronic
1154033534 18:10775651-10775673 GCCTGTGGCATGGCAGTTTGGGG - Intronic
1154415670 18:14174122-14174144 GCCAGTGCTATGGCAGTGCCAGG + Intergenic
1155157968 18:23173336-23173358 GGCTCTGAAATGACAGTGTCTGG + Intronic
1156505935 18:37592851-37592873 GGGTGAGGTATGGCAGTGAGGGG - Intergenic
1157577128 18:48750774-48750796 GGCTGTCCTATGGCAGCGTGTGG - Intronic
1157749803 18:50168225-50168247 TGCTGTGCTTTGGCAGTGACGGG - Intronic
1159995934 18:74964205-74964227 GGATGTGGTATTCTAGTGTCTGG + Intronic
1161164536 19:2779097-2779119 GGGGGCGGTTTGGCAGTGTCTGG - Intronic
1161683620 19:5692639-5692661 GGCTGTGGTGGGGCTGTGCCTGG - Intronic
1163258708 19:16173550-16173572 GGCTGTTGTGTACCAGTGTCTGG + Intergenic
1163709858 19:18840085-18840107 GGCTCTGAGATGGCAGTGGCGGG + Intronic
1164690903 19:30210209-30210231 GGCCATGGTATGGGAATGTCTGG - Intergenic
1166099008 19:40560036-40560058 GGCTGTGGGATCACAGTGTGAGG + Intronic
1168232875 19:55044539-55044561 GGCTATGGCATGGCTGTGCCGGG - Exonic
927034478 2:19159386-19159408 ATCTGTGGTATGGCAGTATGTGG - Intergenic
929136770 2:38632083-38632105 GGCTGTGGAATTGCACTGTTGGG - Intergenic
929732385 2:44509647-44509669 GTCCCTGGTATGGCAGTGTTGGG + Intronic
930899223 2:56483237-56483259 GGCTGTGGTTTTGCAGTCTTTGG - Intergenic
938341920 2:130541504-130541526 GGCTGTGGGCTGGCACAGTCAGG - Intronic
938347912 2:130579207-130579229 GGCTGTGGGCTGGCACAGTCAGG + Intronic
941167424 2:162097747-162097769 GGATGTGGGATGGCCGAGTCTGG - Intergenic
943203535 2:184860713-184860735 GGCAGTGGCATGGCAATGGCTGG + Intronic
945410258 2:209498716-209498738 AGCAGTGGTATGACAGTGTCTGG + Intronic
946180201 2:217944229-217944251 GGCTCTGGGAAGGCCGTGTCAGG + Intronic
947170645 2:227307803-227307825 TGCTGTGGTTTGACTGTGTCGGG - Exonic
947873983 2:233456274-233456296 AGCTGTGGTAGAGCAGTGCCCGG + Intronic
948916791 2:241038575-241038597 GGCTGTGGGAAGACAGTGGCAGG - Intronic
1168862794 20:1058124-1058146 GTTTGTGGTAGGGCAGTTTCAGG - Intergenic
1170713658 20:18813900-18813922 GGATGTGGCATGGCAGGTTCTGG - Exonic
1173061557 20:39666666-39666688 AGCTGTGGTTTAGGAGTGTCGGG + Intergenic
1174606420 20:51765163-51765185 GGCTGGGGGATGGCAGCGTGAGG - Intronic
1174742206 20:53025983-53026005 GGCTGTGGTATGGCAGTGTCTGG + Intronic
1174875620 20:54223454-54223476 GGCTGAGGTATGGGGGTCTCAGG - Intronic
1175610283 20:60345447-60345469 GGCTGGGGCCTGCCAGTGTCAGG + Intergenic
1176182189 20:63755223-63755245 TGCTGTGTTATGGTAGTGACCGG - Intronic
1176870151 21:14077549-14077571 GGCTGTGGTGAGCCAGGGTCAGG + Intergenic
1177828311 21:26108479-26108501 GGCTGCAGCATGGCAGTCTCTGG + Intronic
1178750621 21:35299260-35299282 TGCTGTGGTATGGCAGTTCCAGG + Intronic
1180060837 21:45384071-45384093 GGCGGTGGCATGGCCGTGCCGGG + Intergenic
1181639368 22:24188720-24188742 GGCTCAGGTGTGGGAGTGTCAGG - Exonic
1181964390 22:26646400-26646422 GGCTGTGGCGTGGCTGTGTGGGG + Intergenic
1183023479 22:35046098-35046120 AGATGGGGAATGGCAGTGTCAGG - Intergenic
1183182505 22:36270037-36270059 TGGTGTGGTTTTGCAGTGTCTGG + Intergenic
1184680059 22:46067013-46067035 GGGTGTGCTAGTGCAGTGTCCGG + Intronic
1184765634 22:46570597-46570619 GGCTGTGGCAGGGCAGGGTGAGG - Intergenic
1184784961 22:46667141-46667163 GGATGTGGTATGGCAGGGGTGGG + Intronic
949649771 3:6143658-6143680 GGGTATTGAATGGCAGTGTCTGG + Intergenic
950716697 3:14852897-14852919 GGCTGTGGGATGTGTGTGTCTGG + Intronic
952741479 3:36738563-36738585 GGCTGTGCTGGGCCAGTGTCAGG + Exonic
955479713 3:59377210-59377232 GGCTGGGCTAAGGCAGGGTCTGG - Intergenic
956582884 3:70833715-70833737 GGATGAGGTAAGGCAGTGACAGG - Intergenic
956798210 3:72734951-72734973 GGCTGTGGAATGGGAGTGCCAGG + Intergenic
957447510 3:80333359-80333381 GCCTGTGGTTTTGCAGTCTCAGG + Intergenic
958584538 3:96069343-96069365 GGCTGGGTTGTGACAGTGTCTGG + Intergenic
960155924 3:114297214-114297236 GGCTCTGGAATTGCACTGTCTGG + Intronic
961179661 3:124866694-124866716 GGCTGGGATATGGCAGGGCCTGG + Intronic
961288561 3:125826587-125826609 GGCTGTGTTAGGGCATTGTGGGG - Intergenic
965087098 3:164113528-164113550 GCCTGCGGGATGGCAGCGTCAGG - Intergenic
968531267 4:1093018-1093040 GCCTGTGGTAGGGCAGAGGCTGG + Intronic
968839095 4:2988146-2988168 GGCAGTGGTTTGGAAGAGTCTGG - Intronic
969009480 4:4049956-4049978 GGCTGTGTTAGGGCATTGTGTGG + Intergenic
969563939 4:7966726-7966748 GGCTGTAGAGTGGCTGTGTCGGG - Exonic
969610420 4:8224973-8224995 GGCTGAGGTGTTGCAGGGTCAGG - Intronic
969744870 4:9062358-9062380 GGCTGTGTTAGGGCATTGTGTGG - Intergenic
969804287 4:9594464-9594486 GGCTGTGTTAGGGCATTGTGGGG - Intergenic
971047997 4:22827683-22827705 GATTGTGGTGTGGCTGTGTCAGG - Intergenic
979490928 4:121326873-121326895 GGCTGTGTTATATCAGTGTATGG + Intergenic
980249792 4:130300277-130300299 GCCTGTGGAATGGTAGTTTCCGG + Intergenic
986098883 5:4586970-4586992 GGGTGGGGTTTGCCAGTGTCAGG - Intergenic
986658255 5:10036386-10036408 GGCTGTGGTCTGGCATGCTCTGG - Intergenic
987248752 5:16078168-16078190 GGCTGTGGAGTGACAGGGTCTGG + Intronic
991936791 5:71810165-71810187 AGGTGGGGAATGGCAGTGTCCGG - Intergenic
993991284 5:94661055-94661077 GGATGTAGTCTGGTAGTGTCTGG + Intronic
994934055 5:106229423-106229445 GGTTGGGGAATGGCAGTGTTTGG + Intergenic
996758627 5:126964111-126964133 GGTTATGGTCTGGCAGTGTTAGG - Intronic
997209847 5:132070794-132070816 GGCTGTGGCAGGGCAGAGGCGGG - Intergenic
997409355 5:133679349-133679371 GGCTGTGCTTGGCCAGTGTCTGG - Intergenic
999912764 5:156223099-156223121 GTCTGTGGTTTGGCAGTGGGTGG + Intronic
1003638961 6:7860518-7860540 GGCTGTGGGATGACGGTGTGAGG - Intronic
1013171631 6:107641530-107641552 GGCATTGATGTGGCAGTGTCTGG + Intronic
1016273513 6:142319771-142319793 GGCTGTGGTAAAGTAATGTCAGG - Intronic
1017087134 6:150724023-150724045 TTCTGTGGTGTGGCAGAGTCAGG + Intronic
1017891329 6:158642214-158642236 GGCTGTTCTCTGTCAGTGTCTGG + Intronic
1018705686 6:166461856-166461878 GGCTGTGGTGGGGCAGGGGCAGG - Intronic
1019600783 7:1882707-1882729 GCCTGTGGCAGGGCAGTGGCTGG - Intronic
1020264835 7:6553419-6553441 AGCTGGGGAATGGCAGTGCCAGG + Intergenic
1021799263 7:24287631-24287653 AGGTGTGATTTGGCAGTGTCTGG + Intronic
1023998703 7:45177496-45177518 GGCTGTGGTCAGGCAGTGGTTGG - Intronic
1024233842 7:47383207-47383229 GGCTGTGGTGTGCCACTGTGTGG - Intronic
1027160678 7:75800093-75800115 GGCTGTGGTCAGGGAGGGTCTGG - Intergenic
1029068443 7:97875475-97875497 GGCTGTGTTAGGGCATTGTGTGG + Intergenic
1029092546 7:98059398-98059420 GGCTGTGATATGGCAGAGCCCGG - Intergenic
1031972204 7:128073052-128073074 GGCAGAGGTATGGCAGTGGAAGG + Intronic
1034902417 7:154915665-154915687 GGCTGAGGTTGTGCAGTGTCAGG - Intergenic
1036250765 8:7160631-7160653 GGCTGTGTTAGGGCATTGTGGGG + Intergenic
1036366725 8:8126826-8126848 GGCTGTGTTAGGGCATTGTGGGG - Intergenic
1039833365 8:41235774-41235796 GGCTGTGGTTTGGGGGGGTCTGG + Intergenic
1041798451 8:61772109-61772131 TGATTTGGTAGGGCAGTGTCGGG + Intergenic
1047004144 8:120602311-120602333 GGCTATGGTATGCCACTGTTTGG + Intronic
1047409807 8:124615152-124615174 GGATGTGGCATGGCAGTGAGAGG + Intronic
1048825223 8:138417514-138417536 GGCAGTGGTGGGGCAGTGGCTGG - Intronic
1048987175 8:139740897-139740919 CACTGTGGTCTGGCTGTGTCAGG + Intronic
1049747516 8:144269278-144269300 GGCTGTGGCCTGGCAGGGTTGGG - Intronic
1050294983 9:4195662-4195684 GGCTATGGCATGGCACTGGCGGG + Intronic
1050498102 9:6265736-6265758 AGCTGTGGTATGCCAGTGGGTGG + Intergenic
1051331160 9:16026216-16026238 GGCTCTGGTGTGGCAGGGTTAGG - Intronic
1053297943 9:36928268-36928290 GGCGGAGGTAGGACAGTGTCTGG - Intronic
1053344802 9:37370528-37370550 GGCTGTGGCATGGGAGTGAGGGG + Intergenic
1053459036 9:38254280-38254302 GGCTGTGACATGGCAATGGCAGG - Intergenic
1054786600 9:69216351-69216373 GGATTTGGAATTGCAGTGTCCGG + Exonic
1055266605 9:74500309-74500331 TACTGTGGTAGGGCACTGTCCGG - Intronic
1056273990 9:84975002-84975024 GGCTGCAGTTTGGCAGTGCCAGG + Intronic
1058737235 9:107904913-107904935 GGCAGTGGAGTGGCAGAGTCTGG + Intergenic
1059396614 9:114038163-114038185 GGCTGTGCTGTGGGAGTCTCAGG - Intronic
1059424006 9:114209580-114209602 GGATGTGGGATGGCAGTGGTGGG + Intronic
1060104547 9:120865679-120865701 GGTTGTGGGATGTCAGTGGCAGG - Intronic
1060489081 9:124068737-124068759 GGCTGTGCTATGGGATTTTCTGG - Intergenic
1061485869 9:130920181-130920203 GGCTGTGGGCTGGCAATGGCTGG + Intronic
1062264009 9:135678538-135678560 GGCTGAGGTATGACCGTGGCTGG + Intergenic
1203790422 EBV:148644-148666 GGGTGTGGTATGGCACAGGCTGG + Intergenic
1185826465 X:3255916-3255938 GCCTTTGAAATGGCAGTGTCTGG + Intergenic
1186688436 X:11949752-11949774 GGCTGTGGCTTGGCAGAATCTGG + Intergenic
1190055010 X:47176175-47176197 GGGTGTGGCCTGGCAGTGTCAGG + Intronic
1191661576 X:63657071-63657093 AGATGTGGTATGGCTGAGTCAGG + Intronic
1192719572 X:73678245-73678267 GGCTGTGGTAAGGCTTTGTTTGG + Intronic
1195082667 X:101386035-101386057 GTCTGGGGTATGGCAGGGGCTGG - Intronic
1196800347 X:119537677-119537699 GGCTGTGGTATGGGAGTTTGTGG + Intergenic
1198103510 X:133441397-133441419 AGCTGTGCCATGGCAGTGTCAGG + Intergenic