ID: 1174743330

View in Genome Browser
Species Human (GRCh38)
Location 20:53038036-53038058
Sequence CCTCCCCGAAGGTGATCCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 132}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174743330_1174743336 -3 Left 1174743330 20:53038036-53038058 CCGCAGGATCACCTTCGGGGAGG 0: 1
1: 0
2: 1
3: 6
4: 132
Right 1174743336 20:53038056-53038078 AGGGAACGACAGCCTGCCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 85
1174743330_1174743335 -4 Left 1174743330 20:53038036-53038058 CCGCAGGATCACCTTCGGGGAGG 0: 1
1: 0
2: 1
3: 6
4: 132
Right 1174743335 20:53038055-53038077 GAGGGAACGACAGCCTGCCCGGG 0: 1
1: 0
2: 1
3: 11
4: 159
1174743330_1174743334 -5 Left 1174743330 20:53038036-53038058 CCGCAGGATCACCTTCGGGGAGG 0: 1
1: 0
2: 1
3: 6
4: 132
Right 1174743334 20:53038054-53038076 GGAGGGAACGACAGCCTGCCCGG 0: 1
1: 0
2: 2
3: 16
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174743330 Original CRISPR CCTCCCCGAAGGTGATCCTG CGG (reversed) Intronic
900032995 1:384783-384805 CCACCCTGAAGCTGATCCTCTGG - Intergenic
900053836 1:614673-614695 CCACCCTGAAGCTGATCCTCTGG - Intergenic
900703619 1:4062749-4062771 CGTCCCCGCAGTTGTTCCTGTGG + Intergenic
903741838 1:25562895-25562917 CCTCCCCAAAGGTGCTTGTGAGG + Intronic
903817915 1:26078608-26078630 CCTCCCCCAAATTGCTCCTGGGG + Intergenic
903982712 1:27201431-27201453 CCGCCTCGAAGGTGACCCGGCGG + Intergenic
904438999 1:30517564-30517586 CCTCCCTGAATGTGAGCCTTCGG - Intergenic
905696840 1:39980825-39980847 CCTGCCCCAAGGTGATCCAAGGG + Intergenic
907043157 1:51281513-51281535 CCTGACCTCAGGTGATCCTGAGG - Intergenic
907589248 1:55650276-55650298 CTTCCTCCAAAGTGATCCTGGGG + Intergenic
915013187 1:152708960-152708982 CCTCCCCCAAGGTGATGAAGAGG - Intronic
922255357 1:223888934-223888956 CCACCCTGAAGCTGATCCTCTGG - Intergenic
922504701 1:226119741-226119763 CCTCCCCTAGGGTGATGCTCAGG - Intergenic
923498125 1:234542398-234542420 CCACCCCGAGGGTGGCCCTGTGG + Intergenic
924336560 1:242991801-242991823 CCACCCTGAAGCTGATCCTCTGG - Intergenic
1062895128 10:1097488-1097510 ATGCCCCGAAGGTGATTCTGAGG + Intronic
1064977745 10:21136067-21136089 CAACCCAGAATGTGATCCTGTGG - Intronic
1072616913 10:97056269-97056291 CCTCCCAGCAGGTGGGCCTGGGG - Intronic
1074983098 10:118635195-118635217 CCTGACCCAAGGTGACCCTGAGG + Intergenic
1074984152 10:118642373-118642395 CCACCAGGAAGGTGAGCCTGGGG + Intergenic
1078110466 11:8388007-8388029 CCTCTCCGAACTAGATCCTGTGG - Intergenic
1083471919 11:62889727-62889749 CCTACCTGAAGGTGGTCATGGGG - Intergenic
1083813857 11:65120866-65120888 CCTCCCTGGAGATGAGCCTGAGG - Intronic
1085197309 11:74680448-74680470 CCTCACCGAGGGTGAGCCTGGGG + Intergenic
1087983606 11:104649259-104649281 CCTCCCCAAAAGTTATCCTCAGG - Intergenic
1089261470 11:117226754-117226776 CCTCCCTGGAGGTGGTTCTGTGG - Intronic
1090229985 11:125095243-125095265 CCTACCCAGAGGGGATCCTGTGG - Intergenic
1091637317 12:2207097-2207119 GCTCCTCGAATGTGGTCCTGGGG - Intronic
1096229005 12:49887262-49887284 CCTACCCGCAGGTGCTCCCGAGG + Intronic
1096482610 12:51952214-51952236 CCTCCCTCCAGGTGCTCCTGGGG + Intronic
1101462623 12:104912365-104912387 CCTCCCCAAAGGTGTTTGTGTGG - Intronic
1102688769 12:114744153-114744175 CCACCCCAAAGGGGATCCTGTGG + Intergenic
1102731448 12:115114472-115114494 CCTCTCCCAAGGTTATTCTGAGG + Intergenic
1107818683 13:44266983-44267005 GCTCCTGGAAGGTGAGCCTGAGG + Intergenic
1113418871 13:110154420-110154442 CCTCCACGAAGGCCCTCCTGGGG - Intronic
1114469232 14:22947805-22947827 CTTCCCCAAAAGTGCTCCTGGGG + Intronic
1120782956 14:88502378-88502400 AATCCCAGAAGGTGATCCAGAGG - Intronic
1121126212 14:91408321-91408343 GCTTCCTGAAGGTGACCCTGAGG - Intronic
1122397336 14:101442580-101442602 CCTCCCTGAAGGAGATCCGGGGG - Intergenic
1123970578 15:25504409-25504431 CCTCCCCCTAGGTGGGCCTGGGG - Intergenic
1127786842 15:62363116-62363138 CCTCCCCAAATATGATCTTGCGG - Intergenic
1129145271 15:73641398-73641420 CCTCCCCTAAGGTCATGGTGTGG + Intergenic
1129840634 15:78741283-78741305 CCTCCCCACAGATGATTCTGAGG + Intergenic
1130878245 15:88032645-88032667 CCTCTGCGAAGGGGGTCCTGTGG - Intronic
1131851523 15:96548884-96548906 CCTCCCAGAAGGTGGCCATGAGG + Intergenic
1134194869 16:12151960-12151982 CCTGACCTCAGGTGATCCTGAGG + Intronic
1134786974 16:16953357-16953379 CCTGCTTGAAGGTGCTCCTGAGG + Intergenic
1135781501 16:25306255-25306277 CCTCTCCAAAGGTGATCGTATGG - Intergenic
1136081049 16:27852849-27852871 CCTCCCCGCAGGTGAGGATGAGG + Intronic
1137859249 16:51829953-51829975 CTTCCGCCAAGGTGCTCCTGGGG + Intergenic
1137920268 16:52480153-52480175 CCTCCCTGGGGTTGATCCTGAGG - Intronic
1139910207 16:70393008-70393030 CCTTCCAGAAAGTGATTCTGGGG + Intronic
1142192282 16:88723464-88723486 CCTCCCGGATGGGGACCCTGAGG + Intronic
1143070026 17:4283926-4283948 CCTGACCTCAGGTGATCCTGAGG - Intronic
1144019138 17:11224400-11224422 CTTCCCTTAAGGTGCTCCTGTGG + Intergenic
1149655746 17:58308836-58308858 CCTTCCCGGAGGTGCTCCCGTGG - Exonic
1150003376 17:61455505-61455527 CCTGCCCGAAGCAGGTCCTGGGG - Intronic
1151474512 17:74338152-74338174 CCTCCCAGAGGGTGCTCCTCAGG + Intronic
1151772316 17:76172093-76172115 CCTCCCCAGAGTTGACCCTGGGG + Intronic
1152191410 17:78890427-78890449 CCTGACCTCAGGTGATCCTGAGG + Intronic
1152260681 17:79265269-79265291 CCTCCCCGAAGCCGGCCCTGGGG + Intronic
1159798760 18:72870915-72870937 CCTGGCCAAAAGTGATCCTGTGG + Intergenic
1160865574 19:1254468-1254490 CCTGCCCGGAGGTGAGCCTGGGG + Exonic
1163501940 19:17681323-17681345 CTTCCCCCAAGCTAATCCTGGGG - Intronic
1164763388 19:30744818-30744840 CCTTCACGCAGGTGGTCCTGAGG + Intergenic
1165706105 19:37977390-37977412 CCTGACCTCAGGTGATCCTGAGG + Intronic
926826098 2:16906306-16906328 CCTCCCCTTTGGTGATTCTGTGG + Intergenic
928280377 2:29941071-29941093 CCTCCCCGAAGCTCATTCTGTGG - Intergenic
930348484 2:50218046-50218068 CCTCTGCAAAGGTGCTCCTGAGG + Intronic
937324636 2:120983168-120983190 CCTCCCCAAAGGCCATCATGAGG + Intronic
937335770 2:121061556-121061578 CCTGACTGCAGGTGATCCTGAGG + Intergenic
938702349 2:133890827-133890849 ACTCCCCTGAGGTGATGCTGTGG + Intergenic
944363124 2:198882633-198882655 CCTCTCTGAAGGAGATTCTGAGG - Intergenic
947254563 2:228147806-228147828 CCTCCCCTACTGTGATGCTGTGG - Intronic
947790979 2:232869221-232869243 CCTCCCAGAAGGCAGTCCTGTGG - Intronic
948313046 2:237004018-237004040 CCTGGTGGAAGGTGATCCTGGGG + Intergenic
948650715 2:239441852-239441874 CCTCCCAGAGTGTAATCCTGGGG - Intergenic
1169093049 20:2873075-2873097 CCTCTCCAAACGTGATACTGTGG - Intronic
1171250163 20:23640461-23640483 CATGCCTGAAGGTGACCCTGTGG + Intergenic
1171256265 20:23690991-23691013 CATGCCTGAAGGTGACCCTGTGG + Intergenic
1171263618 20:23752901-23752923 CATGCCTGAAGGTGACCCTGTGG + Intergenic
1171272665 20:23828670-23828692 CATGCCTGAAGGTGACCCTGTGG + Intergenic
1171279113 20:23881617-23881639 CATGCCTGAAGGTGATCCTGCGG + Intergenic
1174743330 20:53038036-53038058 CCTCCCCGAAGGTGATCCTGCGG - Intronic
1175926723 20:62474993-62475015 ACTCACCGAAGGTGGGCCTGCGG + Exonic
1176144379 20:63559113-63559135 CCTGCCCCAGGGAGATCCTGAGG + Intronic
1176146629 20:63568396-63568418 CCTCCCTGGAGGTCATCCGGAGG - Exonic
1179495141 21:41766737-41766759 CCCCCCCGAAGCTGCTCCGGGGG + Intronic
1181310234 22:21940718-21940740 GCTCCAGGAAGCTGATCCTGGGG + Intronic
1182885823 22:33773196-33773218 CCTCCCTGAAGGTGATCCTCTGG + Intronic
1184744884 22:46450402-46450424 CATCCCCAAATGTGAACCTGGGG - Intronic
1184783706 22:46661805-46661827 CCTCCCCGAAGGGGACCAAGTGG + Intronic
950435122 3:12974807-12974829 CCTCCCTGAGGGTGCTGCTGTGG - Intronic
953665451 3:44922831-44922853 CCTCCTCAAAGGTGTTCTTGAGG - Intronic
953709678 3:45259633-45259655 CCTCCCAGAAGGGGCTCCAGGGG - Intergenic
955126234 3:56115360-56115382 CCTCCTCGAAGGTGAGACTTGGG + Intronic
957005939 3:74946826-74946848 CCATCCAGCAGGTGATCCTGTGG - Intergenic
962760637 3:138510184-138510206 CCTGACCTCAGGTGATCCTGAGG - Intronic
969549533 4:7855514-7855536 CCTCCCAGAAGGTTATTATGAGG - Exonic
969706416 4:8794613-8794635 ACTCCCCGAAGGTAACACTGGGG - Intergenic
973100119 4:46256563-46256585 CCTCCCCCAAGGTGTTACTTTGG + Intronic
979240569 4:118443509-118443531 CCACCCTGAAGCTGATCCTCTGG + Intergenic
982380361 4:154742738-154742760 CCTCCTCGAGGGTGGTCCTAGGG - Intronic
983899843 4:173122210-173122232 CCTCCCTGAAGGTCATCCCTAGG + Intergenic
988358646 5:30207838-30207860 CCTCTGCTAAGGTGATCCTTTGG + Intergenic
990639211 5:57762609-57762631 CCTCCATGAAGGTGGCCCTGTGG - Intergenic
999438163 5:151580552-151580574 CCTCCCACAAGGGGCTCCTGGGG - Intergenic
1002740825 5:181434085-181434107 CCACCCTGAAGCTGATCCTCTGG + Intergenic
1005157536 6:22823726-22823748 CCTACTCTAAAGTGATCCTGGGG - Intergenic
1007435953 6:41810772-41810794 CCTGACCTCAGGTGATCCTGAGG + Intronic
1008326402 6:50187393-50187415 CCTCTCCAAAGGTCAGCCTGAGG + Intergenic
1012329253 6:97963862-97963884 CATCCCAGAAGTTGAACCTGAGG - Intergenic
1013012731 6:106134734-106134756 CCTCCCCTAGGGTTGTCCTGTGG - Intergenic
1013878288 6:114861807-114861829 TCTCCCAGAAAGAGATCCTGAGG + Intergenic
1019245933 6:170709681-170709703 CCACCCTGAAGCTGATCCTCTGG + Intergenic
1024594248 7:50918643-50918665 CCTCCCAGAAGCTTTTCCTGTGG + Intergenic
1025854885 7:65268057-65268079 CCTGCCCTCAGGTGAACCTGAGG + Intergenic
1029002461 7:97168279-97168301 CCTCCCCCAAATTGCTCCTGGGG - Intronic
1031596645 7:123657056-123657078 CCTTTACGATGGTGATCCTGAGG + Intronic
1032153908 7:129452974-129452996 TCTCCCAGAAGCAGATCCTGAGG - Intronic
1032578573 7:133081895-133081917 CCGCCTCGAAGGTGACCCGGCGG + Exonic
1035502189 8:98517-98539 CCACCCTGAAGCTGATCCTCTGG - Intergenic
1047892684 8:129330121-129330143 TCTCCCAGAAGCTGACCCTGAGG + Intergenic
1048225914 8:132585165-132585187 CCTCCCCGAGCTTGATGCTGGGG - Intronic
1049322263 8:142002838-142002860 CCTCCCAGAGGGCGCTCCTGAGG + Intergenic
1049649616 8:143759426-143759448 CCTGCCTGAAGGTGCTGCTGAGG + Intergenic
1050850362 9:10277793-10277815 CCTTCCCCAAGGAGATTCTGAGG + Intronic
1053419654 9:37969379-37969401 CCTCCCAGAGGGTGATTATGAGG + Intronic
1055290541 9:74778275-74778297 CCTCCCACAGGGGGATCCTGTGG - Intronic
1057678500 9:97154293-97154315 CCCCACCGAGGGTGGTCCTGGGG + Intergenic
1060481337 9:124018332-124018354 CCTCCCCGGATCCGATCCTGGGG + Intronic
1062478557 9:136741325-136741347 AGTCCCAGGAGGTGATCCTGAGG - Exonic
1203606133 Un_KI270748v1:58892-58914 CCACCCTGAAGCTGATCCTCTGG + Intergenic
1188133405 X:26466069-26466091 CCTGACCTCAGGTGATCCTGAGG - Intergenic
1189271557 X:39755575-39755597 CCTTCCCAAAGGCGATCGTGTGG - Intergenic
1195049080 X:101080427-101080449 CCAACCCTAGGGTGATCCTGCGG - Intronic
1195261873 X:103140118-103140140 CCTGACCTAAGGTGATCCTCTGG + Intergenic
1200607537 Y:5285064-5285086 CCACCCTGAAGTAGATCCTGGGG + Intronic
1202388291 Y:24345328-24345350 CCACCCTGAAGCTGATCCTCTGG + Intergenic
1202482496 Y:25324800-25324822 CCACCCTGAAGCTGATCCTCTGG - Intergenic