ID: 1174744020

View in Genome Browser
Species Human (GRCh38)
Location 20:53043894-53043916
Sequence CTCAAACATCTGTACTTCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 83}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174744018_1174744020 25 Left 1174744018 20:53043846-53043868 CCTTGGTAAACAAATTTAATAGT 0: 1
1: 0
2: 0
3: 26
4: 280
Right 1174744020 20:53043894-53043916 CTCAAACATCTGTACTTCGCTGG 0: 1
1: 0
2: 0
3: 8
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174744020 Original CRISPR CTCAAACATCTGTACTTCGC TGG Intronic
913300970 1:117367932-117367954 CTTCAACATCTGTACTTCATCGG - Exonic
914454231 1:147820678-147820700 CCCATACATCTGTTCTTCTCTGG - Intergenic
920754886 1:208719646-208719668 CTCAAAAATCCGTTCTTGGCTGG - Intergenic
1064949481 10:20832068-20832090 CTCAAATCTCTGGACTTAGCTGG + Intronic
1066491642 10:35900506-35900528 CTCAAACTACTGTACTGGGCAGG - Intergenic
1076868298 10:133180097-133180119 CTCAAACGGCTGCTCTTCGCCGG + Intronic
1079007882 11:16804947-16804969 CACAAACAGCTGAACTTCTCAGG + Intronic
1086457596 11:86974693-86974715 CTTAAACATCTGTTCTTCCTGGG + Intergenic
1090750568 11:129743382-129743404 CTCCAACATGTGTTCTTCGTTGG + Intergenic
1095260472 12:40093620-40093642 CTCAAGCATCTCTTCTTAGCGGG - Intronic
1098996831 12:77130198-77130220 CTTAAACATCTTTAGTTCCCAGG - Intergenic
1105225435 13:18427198-18427220 CTCAACCATCTGCAGTTCGAGGG + Intergenic
1107675110 13:42787853-42787875 CTCAAACACCTGTATGTGGCAGG + Intronic
1107691717 13:42960172-42960194 CTCAAACATATGTAGATCGAAGG + Intronic
1111371823 13:87329052-87329074 CTCTATCATCTGTAGTTCTCAGG - Intergenic
1115862764 14:37707452-37707474 CTTAAACCTCTGTACTTCAGTGG + Intronic
1116730417 14:48613966-48613988 CTTAAACATCTACACTTGGCAGG - Intergenic
1122124688 14:99572588-99572610 CTCTGACATCTGTCCTTTGCTGG + Intronic
1125076705 15:35627735-35627757 CTCAAACATCTGAATTTCTCAGG - Intergenic
1126496302 15:49294346-49294368 CTCAACTATCTGTAGTTCCCTGG - Intronic
1128551596 15:68601249-68601271 CTCAACCATCTCTACATCCCAGG - Intronic
1133227426 16:4348486-4348508 CTCATACTTCTGTACTCCTCAGG + Intronic
1133523151 16:6578408-6578430 CTCATCCATCTGTCCTTGGCTGG + Intronic
1134424402 16:14125982-14126004 CTCAAACTTCTTAACTTCTCTGG + Intronic
1134766226 16:16760556-16760578 CCCAAAGATTTGTACTTCTCAGG + Intergenic
1134979824 16:18598655-18598677 CCCAAAGATTTGTACTTCTCAGG - Intergenic
1140687575 16:77448400-77448422 CTCAACCTTCTGCACTTCACAGG + Intergenic
1142950744 17:3477781-3477803 CTGAAACATCTGTTTTTCTCAGG + Intronic
1151390314 17:73782688-73782710 CTGAAACATCTGGGCTTGGCAGG + Intergenic
1154527936 18:15312325-15312347 CTCAACCATCTGCAGTTCGAGGG - Intergenic
1158086028 18:53652746-53652768 CTTAAACATCTGAACTAAGCAGG + Intergenic
1162784982 19:13029033-13029055 CTCAAATACCTGGACTTCGTGGG - Intronic
1164813159 19:31174259-31174281 CTCAAACATCTGCTCTTCTTGGG - Intergenic
925535317 2:4910498-4910520 CACAAACATCTGACCTTGGCTGG + Intergenic
929284625 2:40121338-40121360 CTCAAACATCTATTACTCGCAGG - Intronic
931836865 2:66108351-66108373 CTGAAAGCTCTGTTCTTCGCTGG + Intergenic
932539040 2:72631856-72631878 CACAAACACATGTACTTTGCAGG + Intronic
935261948 2:101363147-101363169 ATCAAATATCTGTTCTTAGCGGG + Intronic
936591178 2:113806199-113806221 CTAATACAGCTGTACTTAGCTGG + Intergenic
936706630 2:115082723-115082745 CTCATGCATCTGTAGTTAGCTGG - Intronic
937749139 2:125453547-125453569 CTCAAACATCTGAACTCCTGAGG - Intergenic
938527036 2:132143782-132143804 CTCAACCATCTGCAGTTCGAGGG - Intergenic
948350357 2:237334858-237334880 CTCAAACACCTGGACTTCACGGG + Exonic
948663548 2:239521030-239521052 AGCAAACATGTGTACTTCTCAGG - Intergenic
1171203872 20:23264438-23264460 CTCCAACATATGAACTTCGGGGG + Intergenic
1173109382 20:40171562-40171584 CTCAAAAATTTGTAATTCACTGG + Intergenic
1173779512 20:45743080-45743102 CTCAAGCATCTTTCCTTCACAGG + Intergenic
1174744020 20:53043894-53043916 CTCAAACATCTGTACTTCGCTGG + Intronic
1175975025 20:62706573-62706595 CCCAAACCTCTGTACTTGGCCGG + Intergenic
1176769488 21:13056221-13056243 CTCAACCATCTGCAGTTCGAGGG + Intergenic
1180516590 22:16150165-16150187 CTCAACCATCTGCAGTTCGAGGG + Intergenic
1181689535 22:24550843-24550865 TTCACTCATCTGTACTTCTCTGG + Intronic
950747929 3:15105432-15105454 CTCAAACACCTGGGCTTGGCCGG - Intergenic
953567581 3:44046083-44046105 CTCAACCATCTGCACCTGGCAGG - Intergenic
955076685 3:55620577-55620599 CTAAAACATCTCTTCTTCGCAGG + Intronic
957556677 3:81770899-81770921 CTCTAACATCTCTACTTAGATGG + Intergenic
969998784 4:11343027-11343049 CTCAAACATCTCTACTCCTACGG + Intergenic
970243284 4:14031627-14031649 CTCAAGCCTCTGTATTTCTCAGG - Intergenic
970640177 4:18055584-18055606 CTCTAACATCTGGACTTCAGAGG - Intergenic
974434704 4:61841758-61841780 CTAAATCGTCTGTACTTGGCTGG + Intronic
980176843 4:129356256-129356278 GTCAAACTTCTGTACTTCTCTGG + Intergenic
984695351 4:182773972-182773994 CTCAAACTACTGTACTTAGATGG - Intronic
986942800 5:12975784-12975806 TTCACACATCTGCACTTCCCTGG + Intergenic
992487824 5:77211949-77211971 CTCAGACAGCTGTACTGCACTGG - Intronic
993545298 5:89204355-89204377 CTCAAATATCTGTATTTCCAAGG + Intergenic
999893283 5:156001896-156001918 CTCAAAAATATGTACTTCTAAGG + Intronic
1016244022 6:141961989-141962011 CTCAAGCACCTGTGCTTCCCAGG - Intergenic
1017345793 6:153379421-153379443 CTCAAGCATTTGTACTTCACTGG - Intergenic
1018439566 6:163797781-163797803 ATCACACATCTGCACTCCGCAGG - Intergenic
1029933520 7:104398776-104398798 CTCACTCTTCTGTTCTTCGCTGG + Intronic
1030991337 7:116304612-116304634 CTCAAATATCTGAACTACTCAGG - Intronic
1031817366 7:126454582-126454604 CTCCAACATTTGTATTTCGAAGG + Intronic
1035413165 7:158662102-158662124 CTCAAACATGTTTACCTCCCTGG - Intronic
1036575446 8:10023708-10023730 CTAGAACATCTGCATTTCGCAGG + Intergenic
1041043727 8:53872013-53872035 CTCAAAAATCTGTCTTTAGCAGG + Intronic
1041138245 8:54784238-54784260 CTCAATAATCTTTACTTCGTAGG + Intergenic
1042213150 8:66401807-66401829 CTCAACCATATGTAATTCTCTGG + Intergenic
1046838098 8:118825530-118825552 CTCAAACAGCTGGATTTAGCTGG + Intergenic
1048598548 8:135893497-135893519 CATAAACATCTGTACTTTGGAGG - Intergenic
1050092456 9:2028847-2028869 CTCAAACATCTGGACTAGACAGG + Intronic
1053705731 9:40751133-40751155 CTCAACCATCTGCAGTTCGAGGG - Intergenic
1054415808 9:64874740-64874762 CTCAACCATCTGCAGTTCGAGGG - Intergenic
1054783120 9:69184533-69184555 CTCAAACACGTGTACCTCGCTGG + Intronic
1055423012 9:76163340-76163362 CTCCAACAGCTGTTCTTCACAGG - Intronic
1056594562 9:87995969-87995991 ATCAAACATCTGTGCTTTTCAGG + Intergenic
1057125395 9:92612273-92612295 CTCCATGTTCTGTACTTCGCTGG + Intronic
1057570674 9:96202059-96202081 CTCAAAAATCTGTACCTCGAAGG - Intergenic
1057837550 9:98457547-98457569 CTCAAAAAACTGTCCTTCCCGGG + Intronic
1185793179 X:2943199-2943221 CAAAAACATCTGTTCTTTGCAGG - Exonic
1186072042 X:5832700-5832722 CTCAATTATCTGTGCTTCGTAGG + Intergenic
1197669139 X:129256587-129256609 CTCAAGCCTCTGTACTACGATGG + Intergenic
1200748841 Y:6926481-6926503 CACTAATATCTGTACTTCTCTGG - Intronic