ID: 1174750132

View in Genome Browser
Species Human (GRCh38)
Location 20:53103836-53103858
Sequence ACTTGAGGAGCTGCCGCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174750128_1174750132 6 Left 1174750128 20:53103807-53103829 CCACACCTGGATTTTAATATTCA No data
Right 1174750132 20:53103836-53103858 ACTTGAGGAGCTGCCGCAGGTGG No data
1174750126_1174750132 27 Left 1174750126 20:53103786-53103808 CCATGATGAATCTGGCTCTTGCC No data
Right 1174750132 20:53103836-53103858 ACTTGAGGAGCTGCCGCAGGTGG No data
1174750129_1174750132 1 Left 1174750129 20:53103812-53103834 CCTGGATTTTAATATTCATTGTT No data
Right 1174750132 20:53103836-53103858 ACTTGAGGAGCTGCCGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174750132 Original CRISPR ACTTGAGGAGCTGCCGCAGG TGG Intronic