ID: 1174754292

View in Genome Browser
Species Human (GRCh38)
Location 20:53142413-53142435
Sequence TCCCACCAGGTCACATGTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 104}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174754288_1174754292 11 Left 1174754288 20:53142379-53142401 CCCAGGAGGAAAAAGGCTAATTA 0: 1
1: 0
2: 3
3: 19
4: 232
Right 1174754292 20:53142413-53142435 TCCCACCAGGTCACATGTACAGG 0: 1
1: 0
2: 0
3: 10
4: 104
1174754286_1174754292 18 Left 1174754286 20:53142372-53142394 CCAAATGCCCAGGAGGAAAAAGG 0: 1
1: 0
2: 9
3: 148
4: 676
Right 1174754292 20:53142413-53142435 TCCCACCAGGTCACATGTACAGG 0: 1
1: 0
2: 0
3: 10
4: 104
1174754289_1174754292 10 Left 1174754289 20:53142380-53142402 CCAGGAGGAAAAAGGCTAATTAA 0: 1
1: 0
2: 1
3: 22
4: 216
Right 1174754292 20:53142413-53142435 TCCCACCAGGTCACATGTACAGG 0: 1
1: 0
2: 0
3: 10
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174754292 Original CRISPR TCCCACCAGGTCACATGTAC AGG Intronic
902105473 1:14032364-14032386 TTGCTCCAGGTCACATGAACAGG + Intergenic
904576124 1:31506208-31506230 TCTCACCATGTCACATGCACTGG + Intergenic
907570460 1:55478385-55478407 TTCTACCAGCTAACATGTACTGG + Intergenic
911314614 1:96340862-96340884 TCCCATGAGGTCACATGTGTGGG - Intergenic
911781024 1:101878633-101878655 TGCCACCAGCTCACAGGTAATGG - Intronic
912426238 1:109594237-109594259 TTCCACCAGGTCTCATTTCCAGG - Exonic
916932439 1:169592779-169592801 TCACACCAGGTCACCAATACAGG + Intronic
918225167 1:182474604-182474626 TCCCATCTGGTCACCTATACTGG + Intronic
918381430 1:183959620-183959642 TCCCACCAGGAGAGAGGTACTGG + Intronic
918456163 1:184717889-184717911 TACCACCAGGACCCATGTAGTGG - Intronic
919572060 1:199261170-199261192 TCCAAGTAGGTCACATGGACAGG - Intergenic
920439665 1:205971279-205971301 TCCCACAAGCTCACATGCTCTGG - Intergenic
923100077 1:230807140-230807162 GCCAACCAGGTCACATGCTCTGG - Intergenic
923228702 1:231963492-231963514 GCCCACCAGGGCACATGCAGAGG - Intronic
1062900147 10:1137963-1137985 TCCCCCCAGGTCAGATGTGCTGG - Intergenic
1066471438 10:35701797-35701819 CCCCACCAGGTGCCATGTCCTGG + Intergenic
1069713557 10:70506514-70506536 TGGCAGCAGGTAACATGTACTGG - Intronic
1070423144 10:76257934-76257956 TCCCACCAGGTAACATGCCCAGG - Intronic
1070692198 10:78535443-78535465 TTCCACCAGGTCTTATGTGCTGG - Intergenic
1072686370 10:97539748-97539770 TCCCACCAGGCCACAAGAGCAGG - Intronic
1075127533 10:119712451-119712473 TCCAAACAGGTAACATTTACAGG + Intergenic
1075992206 10:126847801-126847823 TCCAACCAGCTCACATAGACTGG + Intergenic
1077419555 11:2444185-2444207 TCCCACCAGGGCCCTTGGACCGG - Intergenic
1086241635 11:84700931-84700953 TTCCACCAAGACATATGTACCGG + Intronic
1093801771 12:23382272-23382294 TCCCACCAGGTCACACCTCCAGG + Intergenic
1093917668 12:24823710-24823732 TCCCACCATGTAATATGTACTGG + Intronic
1095288399 12:40444429-40444451 CCCCTCCATGTCACATGCACAGG - Exonic
1099308863 12:80993348-80993370 TCCCATGAGATCACAGGTACAGG - Intronic
1099671421 12:85698977-85698999 ACATTCCAGGTCACATGTACTGG + Intergenic
1105799401 13:23890242-23890264 TCAAATAAGGTCACATGTACAGG - Intergenic
1105849647 13:24322795-24322817 TCAAATAAGGTCACATGTACAGG + Intergenic
1106820923 13:33463668-33463690 TCCCACCAGGTTACATGAAGTGG - Intergenic
1107304046 13:38999134-38999156 TCACACCTGGTCTCATGGACAGG - Intergenic
1111190004 13:84794739-84794761 TCATACCAGGTCAAATTTACTGG - Intergenic
1111946254 13:94668793-94668815 TCCAAACAGGTCACATTAACAGG - Intergenic
1119585965 14:75835263-75835285 TTCCACCAGGTGAAATTTACTGG - Intronic
1124233967 15:27970809-27970831 TCCCACCATGCCATACGTACTGG - Intronic
1124703381 15:31937096-31937118 TCCCACGAGGTCATAGATACAGG - Intergenic
1128318905 15:66679140-66679162 TCCCAGCTGGTCCCATGTCCTGG + Intronic
1130416982 15:83703042-83703064 TCACTCCAGGTCTCATGTCCAGG - Intronic
1132050278 15:98601971-98601993 TCCTAACAGGCCACATGGACTGG - Intergenic
1135374414 16:21933402-21933424 ACCCTCCAGGTCACATGAAGTGG + Intergenic
1135740005 16:24966950-24966972 TCCCTCCAAGTCACATGGAAAGG + Intronic
1138719075 16:59058270-59058292 TCCCATGAGGTCATAGGTACAGG - Intergenic
1140376297 16:74447977-74447999 CTCCACCAGGACACATGTATAGG - Intergenic
1141101764 16:81202696-81202718 ACCCACCAGTTCACATCTCCTGG - Intergenic
1144300518 17:13919363-13919385 TCCCACCATGTAAGATGTGCTGG + Intergenic
1147051169 17:37796138-37796160 TCCCCCCAGGACACACGGACCGG + Intergenic
1147111087 17:38262150-38262172 TCCCATCAGTTCACAAGTACTGG + Intergenic
1147636978 17:41970044-41970066 AGCCACCAGCTCACAGGTACAGG - Intronic
1148198031 17:45728812-45728834 TCCCTCCAGGCCACAAGTGCAGG - Intergenic
1148418423 17:47526291-47526313 TCCCATCAGTTCACAAGTACTGG - Intronic
1150447718 17:65240393-65240415 TCCCACCATGTAAGATGTGCTGG + Intergenic
1151345235 17:73497352-73497374 TCCCACCAGGCCATATATAAGGG - Intronic
1157391310 18:47305802-47305824 TCCTACCAGGCCATATGTTCAGG - Intergenic
1158235034 18:55302814-55302836 TCCCAGGAGGTCACAGGAACTGG - Intronic
1163159946 19:15458413-15458435 TCCCAACAGGTAACCTGGACGGG - Exonic
1166831003 19:45639506-45639528 TCCCACCGGGTCACACATCCCGG + Intronic
1167071050 19:47222082-47222104 TGCCTCCAGGTCTCATGTCCTGG - Intronic
1168297463 19:55384355-55384377 TCCCGCCTGGTCACCTGAACCGG + Exonic
924998312 2:384193-384215 TCCCGCCAGGCCTCATGTGCTGG + Intergenic
925057941 2:869701-869723 TCCCACCAGGTCCCACCTCCAGG - Intergenic
929769979 2:44883609-44883631 CCCCACCATGTCCCATGGACTGG + Intergenic
931501793 2:62876707-62876729 TCCCACCATGTAAGATGTGCTGG - Intronic
932865234 2:75334702-75334724 TTCCAATAGGTCACATGTTCTGG - Intergenic
937639290 2:124193225-124193247 TCAAACAAGGTCACATTTACAGG + Intronic
940073487 2:149715634-149715656 TCACACAAGGTCACATCCACAGG + Intergenic
946326140 2:218985492-218985514 TCCCATCAGGGCACATGGCCCGG - Exonic
948145826 2:235707544-235707566 TCCCACCAGGTCACACGCCGGGG - Intronic
948145883 2:235707783-235707805 TCCCACCAGGTCACACGCTGGGG - Intronic
948145898 2:235707872-235707894 TCTCACCAGGTCACATGCTGGGG - Intronic
948145913 2:235707931-235707953 TCCCACCAGGTCACATGATTGGG - Intronic
948299028 2:236888285-236888307 GCCCACCAGGTCGGCTGTACTGG - Intergenic
948353897 2:237361949-237361971 TCCCTCCAGGTGACATTTGCTGG + Intronic
1174435740 20:50505512-50505534 TCCAAATAGGTCACATTTACAGG - Intergenic
1174754292 20:53142413-53142435 TCCCACCAGGTCACATGTACAGG + Intronic
1175605735 20:60310942-60310964 GCCCACCAGGTCACATCCTCAGG - Intergenic
1176520220 21:7818698-7818720 ACCCACCAGGCCAGATTTACAGG - Exonic
1178654246 21:34448710-34448732 ACCCACCAGGCCAGATTTACAGG - Intergenic
1179245345 21:39628700-39628722 TCCCATTAGGTCCCCTGTACAGG - Intronic
960054058 3:113264177-113264199 TCCCAACAGGTCAGAAGTCCTGG - Intronic
961555435 3:127693728-127693750 TCCCACCAGGATACAGGTTCCGG + Intronic
962041568 3:131712888-131712910 TTCCACCAGCTCAGAAGTACTGG - Intronic
965662860 3:171060478-171060500 TCTCACAAGGTCACCTGGACAGG - Intergenic
969143891 4:5102984-5103006 TCCCACCAGCATCCATGTACTGG + Intronic
978318936 4:107471985-107472007 GCCCACCAGGAAACATCTACTGG + Intergenic
978375894 4:108075295-108075317 TCCCTCCTGTTCACATGGACTGG + Intronic
983142538 4:164170068-164170090 TCCCACAAAGGCAGATGTACAGG + Intronic
994283827 5:97939194-97939216 TCCCACCATGTAAGATGTGCTGG + Intergenic
995821157 5:116234415-116234437 TAGCACAAGGTCACATGGACAGG + Intronic
1003128150 6:3372597-3372619 TCCCCCCATGTCTCATGCACAGG + Intronic
1007322068 6:41034676-41034698 TCCCACCAGGTAACAGCTCCTGG - Exonic
1007740878 6:44008823-44008845 TCCCTCCTGGTCACATTAACAGG + Intergenic
1011745311 6:90402734-90402756 TCCCACCAGCTCACACACACAGG - Intergenic
1019499608 7:1358394-1358416 TCCCAGGTGGTCACATGAACAGG + Intergenic
1019982188 7:4629759-4629781 CCCCACCAGGTCACATGGGTAGG + Intergenic
1024486796 7:49928596-49928618 TCCCATGAGGTCACAGGTGCAGG + Intronic
1028290547 7:89059569-89059591 TCCCACCAGGCCCCATCTCCAGG + Intronic
1034555835 7:151849860-151849882 CCACACAAGGTCACATTTACAGG + Intronic
1039365131 8:36921227-36921249 TTCCACCAGGTGACATGAAGAGG + Intronic
1041709206 8:60877392-60877414 TTCCACCAGTTCACATGCATCGG + Intergenic
1042485811 8:69344372-69344394 TCCAACCACGTCACATCTATGGG - Intergenic
1042854675 8:73254509-73254531 TCCCAGGAGGTCACAGGAACTGG + Intronic
1045677720 8:104626681-104626703 CCCCACAAGGTAACATTTACAGG + Intronic
1049433701 8:142576711-142576733 TCCCACCAGGACCCATGGGCAGG + Intergenic
1050253938 9:3774536-3774558 TACCCCCAGTTCACCTGTACTGG + Intergenic
1053138786 9:35668869-35668891 CCCAACAAGGTCACATATACAGG - Intronic
1053282628 9:36830897-36830919 TGCCACCAGGTCAAAGGTAAGGG - Intergenic
1060090102 9:120735192-120735214 TCCCAGCAGCTCACATTAACTGG + Intergenic
1060600358 9:124873333-124873355 GACCTCCAGTTCACATGTACGGG + Intronic
1060888133 9:127170237-127170259 TCCCACCTGGTCAGCTTTACAGG + Intronic
1186098126 X:6124727-6124749 ACCCACCAGATCACATGTATGGG - Intronic
1186454854 X:9703047-9703069 TCCCTCCATTTCACATGTAATGG + Intronic
1187581938 X:20616499-20616521 TCCCTCCAGGACAGTTGTACTGG - Intergenic
1193813670 X:86081600-86081622 TGACACCAGGTCTCATGTCCAGG + Intergenic